Incidental Mutation 'R4547:Ncdn'
ID 333812
Institutional Source Beutler Lab
Gene Symbol Ncdn
Ensembl Gene ENSMUSG00000028833
Gene Name neurochondrin
Synonyms norbin, neurochondrin-1, neurochondrin-2
MMRRC Submission 041781-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4547 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 126743750-126753438 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 126746674 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 542 (F542S)
Ref Sequence ENSEMBL: ENSMUSP00000101722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030637] [ENSMUST00000106116]
AlphaFold Q9Z0E0
Predicted Effect probably damaging
Transcript: ENSMUST00000030637
AA Change: F542S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030637
Gene: ENSMUSG00000028833
AA Change: F542S

DomainStartEndE-ValueType
Pfam:Neurochondrin 30 637 3e-209 PFAM
low complexity region 649 659 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106116
AA Change: F542S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101722
Gene: ENSMUSG00000028833
AA Change: F542S

DomainStartEndE-ValueType
Pfam:Neurochondrin 30 637 9.1e-217 PFAM
low complexity region 649 659 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127079
Meta Mutation Damage Score 0.9339 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a leucine-rich cytoplasmic protein, which is highly similar to a mouse protein that negatively regulates Ca/calmodulin-dependent protein kinase II phosphorylation and may be essential for spatial learning processes. Several alternatively spliced transcript variants of this gene have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted inactivation of this gene results in early embryonic lethality in the homozygous state and impaired chondrocyte proliferation and differentiation in the heterozygous state. Gene trap mutation resulted in lacrimal gland hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 G T 14: 54,645,667 A909E probably benign Het
Ankrd13a A G 5: 114,775,296 E23G probably benign Het
Ano4 T C 10: 88,981,170 R148G probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Aspm T C 1: 139,478,187 V1604A possibly damaging Het
Cdh1 C A 8: 106,663,903 T625K probably damaging Het
Cfap65 G A 1: 74,907,612 T1313I probably damaging Het
Cfhr3 T G 1: 139,584,913 noncoding transcript Het
Csmd1 T C 8: 16,391,797 D351G possibly damaging Het
Dis3l2 A T 1: 87,049,671 T861S probably benign Het
Dnah6 A T 6: 73,192,405 D404E probably benign Het
Dpm1 A G 2: 168,223,153 L88P probably damaging Het
Fabp3 C T 4: 130,312,452 probably null Het
Fat4 T C 3: 38,951,283 F1944L probably damaging Het
Frmd4a C A 2: 4,473,145 L46I probably damaging Het
Gpr39 G A 1: 125,677,991 V219I probably benign Het
Hace1 T A 10: 45,672,555 probably null Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Klb T A 5: 65,379,928 V867E probably benign Het
Lnpk C G 2: 74,522,286 E351Q probably benign Het
Mettl25 T C 10: 105,826,017 D364G probably damaging Het
Mrc2 G A 11: 105,336,641 V567I probably benign Het
Mrm2 T C 5: 140,328,496 T195A probably benign Het
Naaa C T 5: 92,263,586 probably null Het
Nlrp4e A G 7: 23,336,866 N715D probably benign Het
Nupl2 T C 5: 24,177,970 probably benign Het
Olfr1122 G A 2: 87,388,160 V152I probably benign Het
Olfr720 A T 14: 14,175,854 I76N probably damaging Het
Psg25 A G 7: 18,524,704 L349P probably damaging Het
Rnf213 G T 11: 119,479,670 probably null Het
Scara5 A C 14: 65,670,574 K4N possibly damaging Het
Slc35f5 T C 1: 125,572,382 L211S probably benign Het
Slc44a4 T A 17: 34,927,755 F285I probably damaging Het
Slc8a3 A G 12: 81,314,851 V398A possibly damaging Het
Smc2 T C 4: 52,467,866 S737P probably benign Het
Speer2 T C 16: 69,858,849 K30E probably damaging Het
Synj1 T C 16: 90,988,282 I229V possibly damaging Het
Tac1 A G 6: 7,557,216 D74G probably damaging Het
Tbc1d17 A G 7: 44,841,347 V607A probably benign Het
Tmem132a A G 19: 10,860,200 V582A possibly damaging Het
Traf4 A G 11: 78,161,037 I207T possibly damaging Het
Trio T C 15: 27,818,982 R449G possibly damaging Het
Ubn1 G A 16: 5,072,092 R407H probably damaging Het
Vmn1r19 C T 6: 57,404,789 T109I possibly damaging Het
Vmn2r60 A G 7: 42,135,663 T100A probably null Het
Vsig8 A T 1: 172,560,596 M44L probably benign Het
Zbed5 T A 5: 129,902,851 L547* probably null Het
Other mutations in Ncdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ncdn APN 4 126747188 missense probably benign 0.00
R0031:Ncdn UTSW 4 126750108 splice site probably null
R0135:Ncdn UTSW 4 126746669 missense probably benign 0.37
R0413:Ncdn UTSW 4 126750534 missense possibly damaging 0.52
R1404:Ncdn UTSW 4 126750040 missense probably benign 0.33
R1404:Ncdn UTSW 4 126750040 missense probably benign 0.33
R1486:Ncdn UTSW 4 126748598 missense probably damaging 1.00
R1533:Ncdn UTSW 4 126748698 nonsense probably null
R1785:Ncdn UTSW 4 126745273 critical splice acceptor site probably null
R1786:Ncdn UTSW 4 126745273 critical splice acceptor site probably null
R1789:Ncdn UTSW 4 126752003 missense probably damaging 1.00
R1791:Ncdn UTSW 4 126751939 critical splice donor site probably null
R3406:Ncdn UTSW 4 126748595 missense probably benign 0.09
R4863:Ncdn UTSW 4 126750423 missense probably damaging 1.00
R4916:Ncdn UTSW 4 126749938 missense possibly damaging 0.89
R4917:Ncdn UTSW 4 126749938 missense possibly damaging 0.89
R4918:Ncdn UTSW 4 126749938 missense possibly damaging 0.89
R5218:Ncdn UTSW 4 126750810 missense probably benign 0.13
R5356:Ncdn UTSW 4 126747228 missense probably damaging 1.00
R5617:Ncdn UTSW 4 126745047 missense probably damaging 0.99
R5718:Ncdn UTSW 4 126749950 nonsense probably null
R6057:Ncdn UTSW 4 126745031 missense probably benign 0.05
R6343:Ncdn UTSW 4 126747171 missense possibly damaging 0.74
R6986:Ncdn UTSW 4 126747229 missense probably damaging 1.00
R6988:Ncdn UTSW 4 126747189 missense probably benign 0.00
R8257:Ncdn UTSW 4 126749883 critical splice donor site probably null
R8279:Ncdn UTSW 4 126750406 missense probably benign 0.00
R8804:Ncdn UTSW 4 126750105 missense probably benign 0.09
R8812:Ncdn UTSW 4 126745112 missense possibly damaging 0.52
R9047:Ncdn UTSW 4 126750828 missense possibly damaging 0.69
R9206:Ncdn UTSW 4 126750248 missense probably benign 0.03
R9208:Ncdn UTSW 4 126750248 missense probably benign 0.03
R9289:Ncdn UTSW 4 126750110 missense possibly damaging 0.81
R9353:Ncdn UTSW 4 126750671 missense probably benign 0.00
R9420:Ncdn UTSW 4 126751969 missense probably damaging 1.00
R9578:Ncdn UTSW 4 126752002 missense probably damaging 1.00
Z1176:Ncdn UTSW 4 126750151 missense probably damaging 1.00
Z1176:Ncdn UTSW 4 126750153 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GCTTACACTCCGAACACTGC -3'
(R):5'- GTCACTCAGCTCAGCTACTTGG -3'

Sequencing Primer
(F):5'- GCAAGTCCACTCAGATACTCTGTC -3'
(R):5'- AGCTACTTGGCATCTGACTGAC -3'
Posted On 2015-08-18