Incidental Mutation 'R4547:Naaa'
ID333816
Institutional Source Beutler Lab
Gene Symbol Naaa
Ensembl Gene ENSMUSG00000029413
Gene NameN-acylethanolamine acid amidase
Synonyms3830414F09Rik, Asahl, 2210023K21Rik
MMRRC Submission 041781-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4547 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location92257659-92278170 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 92263586 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113102] [ENSMUST00000113102] [ENSMUST00000159345] [ENSMUST00000159345] [ENSMUST00000175656] [ENSMUST00000175656]
Predicted Effect probably null
Transcript: ENSMUST00000113102
SMART Domains Protein: ENSMUSP00000108726
Gene: ENSMUSG00000029413

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:NAAA-beta 36 127 7.3e-26 PFAM
Pfam:CBAH 131 362 9e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113102
SMART Domains Protein: ENSMUSP00000108726
Gene: ENSMUSG00000029413

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:NAAA-beta 36 127 7.3e-26 PFAM
Pfam:CBAH 131 362 9e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000159345
SMART Domains Protein: ENSMUSP00000124582
Gene: ENSMUSG00000029413

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:NAAA-beta 36 125 1.3e-23 PFAM
Pfam:CBAH 129 360 1.6e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000159345
SMART Domains Protein: ENSMUSP00000124582
Gene: ENSMUSG00000029413

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:NAAA-beta 36 125 1.3e-23 PFAM
Pfam:CBAH 129 360 1.6e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159732
Predicted Effect probably null
Transcript: ENSMUST00000175656
Predicted Effect probably null
Transcript: ENSMUST00000175656
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an N-acylethanolamine-hydrolyzing enzyme which is highly similar to acid ceramidase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 G T 14: 54,645,667 A909E probably benign Het
Ankrd13a A G 5: 114,775,296 E23G probably benign Het
Ano4 T C 10: 88,981,170 R148G probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Aspm T C 1: 139,478,187 V1604A possibly damaging Het
Cdh1 C A 8: 106,663,903 T625K probably damaging Het
Cfap65 G A 1: 74,907,612 T1313I probably damaging Het
Cfhr3 T G 1: 139,584,913 noncoding transcript Het
Csmd1 T C 8: 16,391,797 D351G possibly damaging Het
Dis3l2 A T 1: 87,049,671 T861S probably benign Het
Dnah6 A T 6: 73,192,405 D404E probably benign Het
Dpm1 A G 2: 168,223,153 L88P probably damaging Het
Fabp3 C T 4: 130,312,452 probably null Het
Fat4 T C 3: 38,951,283 F1944L probably damaging Het
Frmd4a C A 2: 4,473,145 L46I probably damaging Het
Gpr39 G A 1: 125,677,991 V219I probably benign Het
Hace1 T A 10: 45,672,555 probably null Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Klb T A 5: 65,379,928 V867E probably benign Het
Lnpk C G 2: 74,522,286 E351Q probably benign Het
Mettl25 T C 10: 105,826,017 D364G probably damaging Het
Mrc2 G A 11: 105,336,641 V567I probably benign Het
Mrm2 T C 5: 140,328,496 T195A probably benign Het
Ncdn A G 4: 126,746,674 F542S probably damaging Het
Nlrp4e A G 7: 23,336,866 N715D probably benign Het
Nupl2 T C 5: 24,177,970 probably benign Het
Olfr1122 G A 2: 87,388,160 V152I probably benign Het
Olfr720 A T 14: 14,175,854 I76N probably damaging Het
Psg25 A G 7: 18,524,704 L349P probably damaging Het
Rnf213 G T 11: 119,479,670 probably null Het
Scara5 A C 14: 65,670,574 K4N possibly damaging Het
Slc35f5 T C 1: 125,572,382 L211S probably benign Het
Slc44a4 T A 17: 34,927,755 F285I probably damaging Het
Slc8a3 A G 12: 81,314,851 V398A possibly damaging Het
Smc2 T C 4: 52,467,866 S737P probably benign Het
Speer2 T C 16: 69,858,849 K30E probably damaging Het
Synj1 T C 16: 90,988,282 I229V possibly damaging Het
Tac1 A G 6: 7,557,216 D74G probably damaging Het
Tbc1d17 A G 7: 44,841,347 V607A probably benign Het
Tmem132a A G 19: 10,860,200 V582A possibly damaging Het
Traf4 A G 11: 78,161,037 I207T possibly damaging Het
Trio T C 15: 27,818,982 R449G possibly damaging Het
Ubn1 G A 16: 5,072,092 R407H probably damaging Het
Vmn1r19 C T 6: 57,404,789 T109I possibly damaging Het
Vmn2r60 A G 7: 42,135,663 T100A probably null Het
Vsig8 A T 1: 172,560,596 M44L probably benign Het
Zbed5 T A 5: 129,902,851 L547* probably null Het
Other mutations in Naaa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Naaa APN 5 92265133 missense probably benign 0.32
IGL01470:Naaa APN 5 92263648 missense probably damaging 1.00
IGL01990:Naaa APN 5 92268063 missense possibly damaging 0.75
IGL02222:Naaa APN 5 92259550 unclassified probably benign
R0254:Naaa UTSW 5 92265135 missense probably damaging 1.00
R1658:Naaa UTSW 5 92272441 splice site probably null
R1930:Naaa UTSW 5 92278035 missense probably benign
R1931:Naaa UTSW 5 92278035 missense probably benign
R3788:Naaa UTSW 5 92272554 splice site probably null
R4182:Naaa UTSW 5 92272554 splice site probably null
R4373:Naaa UTSW 5 92278143 utr 5 prime probably benign
R5198:Naaa UTSW 5 92268045 nonsense probably null
R5732:Naaa UTSW 5 92263455 missense probably damaging 1.00
R6009:Naaa UTSW 5 92259581 missense probably benign
R7037:Naaa UTSW 5 92277075 missense possibly damaging 0.46
R7540:Naaa UTSW 5 92263724 missense probably benign 0.15
R8280:Naaa UTSW 5 92263449 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAATCTACCTTCGGTCATCCAC -3'
(R):5'- GTGTCCAGCAATATGGGATGAG -3'

Sequencing Primer
(F):5'- ACCTTGGGTGCAGGCTTC -3'
(R):5'- CCAGCAATATGGGATGAGGTTGTC -3'
Posted On2015-08-18