Incidental Mutation 'R4547:Zbed5'
ID333818
Institutional Source Beutler Lab
Gene Symbol Zbed5
Ensembl Gene ENSMUSG00000034173
Gene Namezinc finger, BED type containing 5
Synonyms2410018M08Rik
MMRRC Submission 041781-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4547 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location129895723-129903623 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 129902851 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 547 (L547*)
Ref Sequence ENSEMBL: ENSMUSP00000044533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041466] [ENSMUST00000077320] [ENSMUST00000140667]
Predicted Effect probably null
Transcript: ENSMUST00000041466
AA Change: L547*
SMART Domains Protein: ENSMUSP00000044533
Gene: ENSMUSG00000034173
AA Change: L547*

DomainStartEndE-ValueType
low complexity region 16 51 N/A INTRINSIC
low complexity region 60 75 N/A INTRINSIC
Pfam:DUF4371 281 412 1.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000077320
SMART Domains Protein: ENSMUSP00000116455
Gene: ENSMUSG00000034173

DomainStartEndE-ValueType
low complexity region 2 30 N/A INTRINSIC
low complexity region 39 54 N/A INTRINSIC
Pfam:CHCH 95 128 2.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140667
SMART Domains Protein: ENSMUSP00000117510
Gene: ENSMUSG00000025537

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 20 143 4.1e-9 PFAM
Pfam:Pkinase 20 144 3.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202430
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is unusual in that its coding sequence is mostly derived from Charlie-like DNA transposon; however, it does not appear to be an active DNA transposon as it is not flanked by terminal inverted repeats. The encoded protein is conserved among the mammalian Laurasiatheria branch. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 G T 14: 54,645,667 A909E probably benign Het
Ankrd13a A G 5: 114,775,296 E23G probably benign Het
Ano4 T C 10: 88,981,170 R148G probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Aspm T C 1: 139,478,187 V1604A possibly damaging Het
Cdh1 C A 8: 106,663,903 T625K probably damaging Het
Cfap65 G A 1: 74,907,612 T1313I probably damaging Het
Cfhr3 T G 1: 139,584,913 noncoding transcript Het
Csmd1 T C 8: 16,391,797 D351G possibly damaging Het
Dis3l2 A T 1: 87,049,671 T861S probably benign Het
Dnah6 A T 6: 73,192,405 D404E probably benign Het
Dpm1 A G 2: 168,223,153 L88P probably damaging Het
Fabp3 C T 4: 130,312,452 probably null Het
Fat4 T C 3: 38,951,283 F1944L probably damaging Het
Frmd4a C A 2: 4,473,145 L46I probably damaging Het
Gpr39 G A 1: 125,677,991 V219I probably benign Het
Hace1 T A 10: 45,672,555 probably null Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Klb T A 5: 65,379,928 V867E probably benign Het
Lnpk C G 2: 74,522,286 E351Q probably benign Het
Mettl25 T C 10: 105,826,017 D364G probably damaging Het
Mrc2 G A 11: 105,336,641 V567I probably benign Het
Mrm2 T C 5: 140,328,496 T195A probably benign Het
Naaa C T 5: 92,263,586 probably null Het
Ncdn A G 4: 126,746,674 F542S probably damaging Het
Nlrp4e A G 7: 23,336,866 N715D probably benign Het
Nupl2 T C 5: 24,177,970 probably benign Het
Olfr1122 G A 2: 87,388,160 V152I probably benign Het
Olfr720 A T 14: 14,175,854 I76N probably damaging Het
Psg25 A G 7: 18,524,704 L349P probably damaging Het
Rnf213 G T 11: 119,479,670 probably null Het
Scara5 A C 14: 65,670,574 K4N possibly damaging Het
Slc35f5 T C 1: 125,572,382 L211S probably benign Het
Slc44a4 T A 17: 34,927,755 F285I probably damaging Het
Slc8a3 A G 12: 81,314,851 V398A possibly damaging Het
Smc2 T C 4: 52,467,866 S737P probably benign Het
Speer2 T C 16: 69,858,849 K30E probably damaging Het
Synj1 T C 16: 90,988,282 I229V possibly damaging Het
Tac1 A G 6: 7,557,216 D74G probably damaging Het
Tbc1d17 A G 7: 44,841,347 V607A probably benign Het
Tmem132a A G 19: 10,860,200 V582A possibly damaging Het
Traf4 A G 11: 78,161,037 I207T possibly damaging Het
Trio T C 15: 27,818,982 R449G possibly damaging Het
Ubn1 G A 16: 5,072,092 R407H probably damaging Het
Vmn1r19 C T 6: 57,404,789 T109I possibly damaging Het
Vmn2r60 A G 7: 42,135,663 T100A probably null Het
Vsig8 A T 1: 172,560,596 M44L probably benign Het
Other mutations in Zbed5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02225:Zbed5 APN 5 129902133 unclassified probably null
IGL03334:Zbed5 APN 5 129902355 missense possibly damaging 0.66
R0449:Zbed5 UTSW 5 129901726 missense probably damaging 1.00
R0744:Zbed5 UTSW 5 129902272 missense possibly damaging 0.92
R0763:Zbed5 UTSW 5 129902179 missense probably benign 0.00
R1967:Zbed5 UTSW 5 129901669 missense possibly damaging 0.68
R2246:Zbed5 UTSW 5 129902751 missense probably benign 0.01
R2925:Zbed5 UTSW 5 129903198 missense possibly damaging 0.66
R3053:Zbed5 UTSW 5 129902146 missense possibly damaging 0.66
R3701:Zbed5 UTSW 5 129903159 missense possibly damaging 0.90
R3702:Zbed5 UTSW 5 129903159 missense possibly damaging 0.90
R3916:Zbed5 UTSW 5 129902277 missense possibly damaging 0.92
R3917:Zbed5 UTSW 5 129902277 missense possibly damaging 0.92
R4548:Zbed5 UTSW 5 129902851 nonsense probably null
R5195:Zbed5 UTSW 5 129902178 missense probably benign 0.01
R5500:Zbed5 UTSW 5 129901982 nonsense probably null
R5813:Zbed5 UTSW 5 129902218 missense possibly damaging 0.46
R6377:Zbed5 UTSW 5 129903369 missense possibly damaging 0.83
R6620:Zbed5 UTSW 5 129903289 missense possibly damaging 0.82
R6862:Zbed5 UTSW 5 129903185 missense probably benign
R6931:Zbed5 UTSW 5 129903329 nonsense probably null
R7223:Zbed5 UTSW 5 129900438 missense probably damaging 1.00
R7831:Zbed5 UTSW 5 129901957 missense possibly damaging 0.82
R7914:Zbed5 UTSW 5 129901957 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TCGCGTCATGATCGGAGAC -3'
(R):5'- TGCTGTTCAATGTCATGTTCCTC -3'

Sequencing Primer
(F):5'- CGTTTCTGAGACAGCATGAGATCTC -3'
(R):5'- TGTCATGTTCCTCAAAGAAGGCG -3'
Posted On2015-08-18