Incidental Mutation 'R4547:Nlrp4e'
ID333823
Institutional Source Beutler Lab
Gene Symbol Nlrp4e
Ensembl Gene ENSMUSG00000045693
Gene NameNLR family, pyrin domain containing 4E
Synonyms4930406H16Rik, Nalp4e, Nalp-epsilon
MMRRC Submission 041781-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4547 (G1)
Quality Score160
Status Not validated
Chromosome7
Chromosomal Location23301192-23362277 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23336866 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 715 (N715D)
Ref Sequence ENSEMBL: ENSMUSP00000075794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076470]
Predicted Effect probably benign
Transcript: ENSMUST00000076470
AA Change: N715D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000075794
Gene: ENSMUSG00000045693
AA Change: N715D

DomainStartEndE-ValueType
PYRIN 6 89 1.43e-35 SMART
Pfam:NACHT 148 317 1.3e-39 PFAM
LRR 689 716 1.87e1 SMART
LRR 718 745 7.74e0 SMART
LRR 746 772 2.5e1 SMART
LRR 774 801 2.67e1 SMART
LRR 802 829 6.48e-1 SMART
LRR 831 858 2.03e0 SMART
LRR 859 886 2.88e-6 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 1.02e2 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 96% (55/57)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 G T 14: 54,645,667 A909E probably benign Het
Ankrd13a A G 5: 114,775,296 E23G probably benign Het
Ano4 T C 10: 88,981,170 R148G probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Aspm T C 1: 139,478,187 V1604A possibly damaging Het
Cdh1 C A 8: 106,663,903 T625K probably damaging Het
Cfap65 G A 1: 74,907,612 T1313I probably damaging Het
Cfhr3 T G 1: 139,584,913 noncoding transcript Het
Csmd1 T C 8: 16,391,797 D351G possibly damaging Het
Dis3l2 A T 1: 87,049,671 T861S probably benign Het
Dnah6 A T 6: 73,192,405 D404E probably benign Het
Dpm1 A G 2: 168,223,153 L88P probably damaging Het
Fabp3 C T 4: 130,312,452 probably null Het
Fat4 T C 3: 38,951,283 F1944L probably damaging Het
Frmd4a C A 2: 4,473,145 L46I probably damaging Het
Gpr39 G A 1: 125,677,991 V219I probably benign Het
Hace1 T A 10: 45,672,555 probably null Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Klb T A 5: 65,379,928 V867E probably benign Het
Lnpk C G 2: 74,522,286 E351Q probably benign Het
Mettl25 T C 10: 105,826,017 D364G probably damaging Het
Mrc2 G A 11: 105,336,641 V567I probably benign Het
Mrm2 T C 5: 140,328,496 T195A probably benign Het
Naaa C T 5: 92,263,586 probably null Het
Ncdn A G 4: 126,746,674 F542S probably damaging Het
Nupl2 T C 5: 24,177,970 probably benign Het
Olfr1122 G A 2: 87,388,160 V152I probably benign Het
Olfr720 A T 14: 14,175,854 I76N probably damaging Het
Psg25 A G 7: 18,524,704 L349P probably damaging Het
Rnf213 G T 11: 119,479,670 probably null Het
Scara5 A C 14: 65,670,574 K4N possibly damaging Het
Slc35f5 T C 1: 125,572,382 L211S probably benign Het
Slc44a4 T A 17: 34,927,755 F285I probably damaging Het
Slc8a3 A G 12: 81,314,851 V398A possibly damaging Het
Smc2 T C 4: 52,467,866 S737P probably benign Het
Speer2 T C 16: 69,858,849 K30E probably damaging Het
Synj1 T C 16: 90,988,282 I229V possibly damaging Het
Tac1 A G 6: 7,557,216 D74G probably damaging Het
Tbc1d17 A G 7: 44,841,347 V607A probably benign Het
Tmem132a A G 19: 10,860,200 V582A possibly damaging Het
Traf4 A G 11: 78,161,037 I207T possibly damaging Het
Trio T C 15: 27,818,982 R449G possibly damaging Het
Ubn1 G A 16: 5,072,092 R407H probably damaging Het
Vmn1r19 C T 6: 57,404,789 T109I possibly damaging Het
Vmn2r60 A G 7: 42,135,663 T100A probably null Het
Vsig8 A T 1: 172,560,596 M44L probably benign Het
Zbed5 T A 5: 129,902,851 L547* probably null Het
Other mutations in Nlrp4e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Nlrp4e APN 7 23343140 missense probably damaging 1.00
IGL00833:Nlrp4e APN 7 23340471 missense probably benign 0.00
IGL01017:Nlrp4e APN 7 23321667 missense possibly damaging 0.93
IGL01025:Nlrp4e APN 7 23353161 splice site probably benign
IGL01815:Nlrp4e APN 7 23321438 missense probably benign 0.02
IGL01924:Nlrp4e APN 7 23320830 nonsense probably null
IGL02245:Nlrp4e APN 7 23320875 missense probably damaging 1.00
IGL02745:Nlrp4e APN 7 23321291 missense probably damaging 1.00
IGL02746:Nlrp4e APN 7 23321839 missense probably benign 0.00
IGL02987:Nlrp4e APN 7 23301433 missense probably damaging 1.00
IGL02997:Nlrp4e APN 7 23301374 missense probably benign 0.04
IGL03193:Nlrp4e APN 7 23320826 missense probably damaging 1.00
IGL03304:Nlrp4e APN 7 23353343 critical splice donor site probably null
IGL03352:Nlrp4e APN 7 23320826 missense probably damaging 1.00
R0389:Nlrp4e UTSW 7 23355203 missense probably damaging 0.98
R1028:Nlrp4e UTSW 7 23321744 missense probably damaging 1.00
R1163:Nlrp4e UTSW 7 23320972 missense probably benign 0.03
R1269:Nlrp4e UTSW 7 23353338 missense possibly damaging 0.95
R1400:Nlrp4e UTSW 7 23321660 missense possibly damaging 0.93
R1497:Nlrp4e UTSW 7 23320372 missense probably benign 0.00
R1518:Nlrp4e UTSW 7 23321843 missense probably benign 0.33
R1716:Nlrp4e UTSW 7 23321033 missense possibly damaging 0.56
R1727:Nlrp4e UTSW 7 23320995 missense probably benign 0.01
R1998:Nlrp4e UTSW 7 23321246 missense probably benign 0.00
R2177:Nlrp4e UTSW 7 23355261 missense probably benign 0.00
R3724:Nlrp4e UTSW 7 23321377 missense probably benign 0.28
R3767:Nlrp4e UTSW 7 23340563 missense probably damaging 1.00
R3795:Nlrp4e UTSW 7 23320803 missense probably benign 0.35
R4387:Nlrp4e UTSW 7 23301477 missense probably benign 0.00
R4387:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4388:Nlrp4e UTSW 7 23301477 missense probably benign 0.00
R4388:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4389:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4403:Nlrp4e UTSW 7 23321463 nonsense probably null
R4444:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4486:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4553:Nlrp4e UTSW 7 23320979 missense probably benign
R4666:Nlrp4e UTSW 7 23336780 nonsense probably null
R4721:Nlrp4e UTSW 7 23321096 missense possibly damaging 0.84
R4728:Nlrp4e UTSW 7 23321564 missense probably benign
R4758:Nlrp4e UTSW 7 23320618 missense probably benign 0.17
R4775:Nlrp4e UTSW 7 23343100 missense probably benign 0.14
R4830:Nlrp4e UTSW 7 23336740 missense probably benign 0.03
R4954:Nlrp4e UTSW 7 23361893 nonsense probably null
R5277:Nlrp4e UTSW 7 23321438 missense probably benign 0.02
R5352:Nlrp4e UTSW 7 23353173 missense probably benign 0.26
R5521:Nlrp4e UTSW 7 23321765 missense probably benign 0.00
R5528:Nlrp4e UTSW 7 23336891 missense probably benign 0.07
R5537:Nlrp4e UTSW 7 23320489 missense probably benign 0.00
R5584:Nlrp4e UTSW 7 23321177 missense probably benign
R5683:Nlrp4e UTSW 7 23353272 missense probably damaging 0.99
R6160:Nlrp4e UTSW 7 23321306 missense probably damaging 0.99
R6313:Nlrp4e UTSW 7 23353172 missense probably benign
R6427:Nlrp4e UTSW 7 23320633 missense possibly damaging 0.48
R6647:Nlrp4e UTSW 7 23321315 missense probably benign 0.00
R6929:Nlrp4e UTSW 7 23336731 critical splice acceptor site probably null
R7307:Nlrp4e UTSW 7 23321528 missense probably benign 0.07
R7792:Nlrp4e UTSW 7 23321757 missense possibly damaging 0.60
R8169:Nlrp4e UTSW 7 23320506 missense probably benign 0.06
R8445:Nlrp4e UTSW 7 23340540 missense probably benign 0.00
R8487:Nlrp4e UTSW 7 23321558 missense probably benign 0.00
X0022:Nlrp4e UTSW 7 23343119 missense probably damaging 1.00
X0025:Nlrp4e UTSW 7 23343178 missense possibly damaging 0.91
X0026:Nlrp4e UTSW 7 23355223 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TTAGTGGAAACTGATGGATCCCG -3'
(R):5'- CTTAAAGTGAGGAAGTCTACACATG -3'

Sequencing Primer
(F):5'- GAAACTGATGGATCCCGCTCTTTG -3'
(R):5'- AGTAAGACCCCATCCATTGTGGG -3'
Genotyping

Genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the mutation.

 

PCR Primers

R45470032_PCR_F: 5’- TTAGTGGAAACTGATGGATCCCG-3’

R45470032_PCR_R: 5’- CTTAAAGTGAGGAAGTCTACACATG-3’

 

Sequencing Primers

R45470032_SEQ_F: 5’- GAAACTGATGGATCCCGCTCTTTG-3’
 

R45470032_SEQ_R: 5’- AGTAAGACCCCATCCATTGTGGG-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

 

The following sequence of 738 nucleotides is amplified (NCBI RefSeq: NC_000073, chromosome 7):

  

35504                                                ttagtgg aaactgatgg    

35521 atcccgctct ttgttctaca gggtaaataa tgtgactttg ctttgtgata accgcctgtt    

35581 atttgagttg attcagaacc aacgtttgca gctcttgaac ctcagcctca cattcctgtc    

35641 ccacaatgat gtgaaactgt tgtgtgatgt cttgaaccag gcagagtgca acatagaaaa    

35701 gctgatgtaa gtctgtgtgt tctcctagct cactgactcc ccttaaagga ggcatctttg    

35761 ttttgatcca tttgctgtga caaaatgccc tgacctaagc aatgacagag ggaaaaaaaa    

35821 agtgtactgg attcagaatt tcagctttta ggacattgct gtgggaaggc agggtagcaa    

35881 aaatctggaa acataatcac atctcatgca caatcaagag tggactaatg cacacatgct    

35941 agtgatcaac tgactccctc cactactata caggtcagga tcctgcttcc tgaggaatgg    

36001 tgaggaatgg tccacccaca atggatgggg tcttactgcc tcagttggct tcatcaagaa    

36061 atcatgcaca aacatggcca cagagcatcc ctatctagag aagctctcat tgagactccc    

36121 ttgctaggtg attttagatt gtgtcaagtt ggcattaaaa ctatcacagg acaacagttt    

36181 ttcatttgtg cacttgtgtc ctatttttcc attattcatg tgtagacttc ctcactttaa    

36241 g

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (Chr. +: A>G)

Posted On2015-08-18