Incidental Mutation 'R4547:Cdh1'
ID 333827
Institutional Source Beutler Lab
Gene Symbol Cdh1
Ensembl Gene ENSMUSG00000000303
Gene Name cadherin 1
Synonyms Ecad, UM, uvomorulin, E-cad, L-CAM, E-cadherin
MMRRC Submission 041781-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4547 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 106603351-106670246 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 106663903 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 625 (T625K)
Ref Sequence ENSEMBL: ENSMUSP00000132112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000312] [ENSMUST00000167688]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000000312
AA Change: T625K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000000312
Gene: ENSMUSG00000000303
AA Change: T625K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Cadherin_pro 29 118 3.42e-36 SMART
low complexity region 123 131 N/A INTRINSIC
CA 179 262 2.27e-14 SMART
CA 286 375 3.18e-27 SMART
CA 398 487 2e-10 SMART
CA 510 595 1.49e-18 SMART
Pfam:Cadherin 600 688 5.3e-11 PFAM
transmembrane domain 711 733 N/A INTRINSIC
Pfam:Cadherin_C 734 881 1.3e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167688
AA Change: T625K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132112
Gene: ENSMUSG00000000303
AA Change: T625K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Cadherin_pro 29 118 3.42e-36 SMART
low complexity region 123 131 N/A INTRINSIC
CA 179 262 2.27e-14 SMART
CA 286 375 3.18e-27 SMART
CA 398 487 2e-10 SMART
CA 510 595 1.49e-18 SMART
Pfam:Cadherin 600 688 7.1e-10 PFAM
transmembrane domain 711 733 N/A INTRINSIC
Pfam:Cadherin_C 738 880 3.9e-50 PFAM
Meta Mutation Damage Score 0.1829 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: This gene encodes E-cadherin, a calcium-dependent cell adhesion molecule that functions in the establishment and maintenance of epithelial cell morphology during embryongenesis and adulthood. The encoded preproprotein undergoes proteolytic processing to generate a mature protein. Targeted mutations disrupting binding of calcium to the encoded protein in mice cause death in utero due to failed blastocyst and trophectoderm formation. This gene is located adjacent to a related cadherin gene on chromosome 8. [provided by RefSeq, Oct 2015]
PHENOTYPE: In mutant homozygotes, adhesive cells of the morula dissociate shortly after initial compaction, probably due to depletion of maternal protein. Mutant embryos fail to form a trophectodermal epithelium or blastocyst cavity, and die near implantation time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 G T 14: 54,645,667 A909E probably benign Het
Ankrd13a A G 5: 114,775,296 E23G probably benign Het
Ano4 T C 10: 88,981,170 R148G probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Aspm T C 1: 139,478,187 V1604A possibly damaging Het
Cfap65 G A 1: 74,907,612 T1313I probably damaging Het
Cfhr3 T G 1: 139,584,913 noncoding transcript Het
Csmd1 T C 8: 16,391,797 D351G possibly damaging Het
Dis3l2 A T 1: 87,049,671 T861S probably benign Het
Dnah6 A T 6: 73,192,405 D404E probably benign Het
Dpm1 A G 2: 168,223,153 L88P probably damaging Het
Fabp3 C T 4: 130,312,452 probably null Het
Fat4 T C 3: 38,951,283 F1944L probably damaging Het
Frmd4a C A 2: 4,473,145 L46I probably damaging Het
Gpr39 G A 1: 125,677,991 V219I probably benign Het
Hace1 T A 10: 45,672,555 probably null Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Klb T A 5: 65,379,928 V867E probably benign Het
Lnpk C G 2: 74,522,286 E351Q probably benign Het
Mettl25 T C 10: 105,826,017 D364G probably damaging Het
Mrc2 G A 11: 105,336,641 V567I probably benign Het
Mrm2 T C 5: 140,328,496 T195A probably benign Het
Naaa C T 5: 92,263,586 probably null Het
Ncdn A G 4: 126,746,674 F542S probably damaging Het
Nlrp4e A G 7: 23,336,866 N715D probably benign Het
Nupl2 T C 5: 24,177,970 probably benign Het
Olfr1122 G A 2: 87,388,160 V152I probably benign Het
Olfr720 A T 14: 14,175,854 I76N probably damaging Het
Psg25 A G 7: 18,524,704 L349P probably damaging Het
Rnf213 G T 11: 119,479,670 probably null Het
Scara5 A C 14: 65,670,574 K4N possibly damaging Het
Slc35f5 T C 1: 125,572,382 L211S probably benign Het
Slc44a4 T A 17: 34,927,755 F285I probably damaging Het
Slc8a3 A G 12: 81,314,851 V398A possibly damaging Het
Smc2 T C 4: 52,467,866 S737P probably benign Het
Speer2 T C 16: 69,858,849 K30E probably damaging Het
Synj1 T C 16: 90,988,282 I229V possibly damaging Het
Tac1 A G 6: 7,557,216 D74G probably damaging Het
Tbc1d17 A G 7: 44,841,347 V607A probably benign Het
Tmem132a A G 19: 10,860,200 V582A possibly damaging Het
Traf4 A G 11: 78,161,037 I207T possibly damaging Het
Trio T C 15: 27,818,982 R449G possibly damaging Het
Ubn1 G A 16: 5,072,092 R407H probably damaging Het
Vmn1r19 C T 6: 57,404,789 T109I possibly damaging Het
Vmn2r60 A G 7: 42,135,663 T100A probably null Het
Vsig8 A T 1: 172,560,596 M44L probably benign Het
Zbed5 T A 5: 129,902,851 L547* probably null Het
Other mutations in Cdh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Cdh1 APN 8 106660884 missense probably damaging 1.00
IGL01405:Cdh1 APN 8 106649001 missense probably damaging 0.97
IGL01410:Cdh1 APN 8 106657853 missense probably benign 0.19
IGL01901:Cdh1 APN 8 106657760 missense probably damaging 0.99
IGL02197:Cdh1 APN 8 106653786 missense probably benign 0.29
IGL02580:Cdh1 APN 8 106649018 missense probably benign 0.01
IGL02690:Cdh1 APN 8 106657884 missense probably damaging 1.00
IGL02732:Cdh1 APN 8 106666323 missense probably damaging 1.00
IGL02927:Cdh1 APN 8 106668511 missense probably damaging 1.00
R1777:Cdh1 UTSW 8 106656835 missense probably damaging 1.00
R1826:Cdh1 UTSW 8 106666266 missense probably benign 0.03
R1892:Cdh1 UTSW 8 106664250 missense possibly damaging 0.72
R2045:Cdh1 UTSW 8 106666182 splice site probably benign
R2100:Cdh1 UTSW 8 106659668 missense possibly damaging 0.57
R2104:Cdh1 UTSW 8 106653759 splice site probably benign
R2118:Cdh1 UTSW 8 106664210 missense probably benign
R2121:Cdh1 UTSW 8 106664210 missense probably benign
R2124:Cdh1 UTSW 8 106664210 missense probably benign
R2125:Cdh1 UTSW 8 106656840 missense probably damaging 0.99
R2163:Cdh1 UTSW 8 106649081 missense probably benign 0.01
R2165:Cdh1 UTSW 8 106664321 missense probably damaging 1.00
R2266:Cdh1 UTSW 8 106662003 missense probably benign
R2761:Cdh1 UTSW 8 106653849 missense possibly damaging 0.90
R5131:Cdh1 UTSW 8 106663798 missense possibly damaging 0.95
R5767:Cdh1 UTSW 8 106668555 missense probably damaging 0.97
R5931:Cdh1 UTSW 8 106666332 critical splice donor site probably null
R6254:Cdh1 UTSW 8 106663798 missense probably damaging 1.00
R6397:Cdh1 UTSW 8 106604290 missense possibly damaging 0.81
R6888:Cdh1 UTSW 8 106658314 missense probably benign 0.09
R6928:Cdh1 UTSW 8 106661010 missense possibly damaging 0.93
R6995:Cdh1 UTSW 8 106660913 missense probably benign 0.02
R7110:Cdh1 UTSW 8 106668544 missense possibly damaging 0.87
R8069:Cdh1 UTSW 8 106657773 missense probably benign 0.26
R8260:Cdh1 UTSW 8 106604347 missense probably benign 0.01
R8387:Cdh1 UTSW 8 106663869 missense probably benign 0.02
R8762:Cdh1 UTSW 8 106659704 missense probably damaging 1.00
R8881:Cdh1 UTSW 8 106666272 missense probably benign 0.00
R8888:Cdh1 UTSW 8 106604339 missense probably damaging 1.00
R8928:Cdh1 UTSW 8 106666238 small deletion probably benign
R8929:Cdh1 UTSW 8 106666238 small deletion probably benign
R8930:Cdh1 UTSW 8 106666238 small deletion probably benign
R8932:Cdh1 UTSW 8 106666238 small deletion probably benign
R9211:Cdh1 UTSW 8 106664330 missense probably benign 0.01
R9472:Cdh1 UTSW 8 106653616 missense probably damaging 1.00
Z1177:Cdh1 UTSW 8 106656839 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGATCCTTAATCTGTGACACC -3'
(R):5'- ATCGAGTGCTGGAGGAATACC -3'

Sequencing Primer
(F):5'- TGACACCTTTTATGTTTTCTCATAGG -3'
(R):5'- CTGGAGGAATACCGCGCAATAC -3'
Posted On 2015-08-18