Incidental Mutation 'R0207:Wdr66'
ID33383
Institutional Source Beutler Lab
Gene Symbol Wdr66
Ensembl Gene ENSMUSG00000029442
Gene NameWD repeat domain 66
Synonyms
MMRRC Submission 038460-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R0207 (G1)
Quality Score185
Status Validated
Chromosome5
Chromosomal Location123252102-123327484 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123283447 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 182 (V182A)
Ref Sequence ENSEMBL: ENSMUSP00000129769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121964] [ENSMUST00000163092] [ENSMUST00000170536]
Predicted Effect probably damaging
Transcript: ENSMUST00000121964
AA Change: V621A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113309
Gene: ENSMUSG00000029442
AA Change: V621A

DomainStartEndE-ValueType
coiled coil region 9 160 N/A INTRINSIC
coiled coil region 243 299 N/A INTRINSIC
WD40 437 478 1.58e-2 SMART
WD40 481 525 6.16e0 SMART
Blast:WD40 532 572 2e-15 BLAST
Blast:WD40 584 623 5e-17 BLAST
low complexity region 627 641 N/A INTRINSIC
WD40 643 677 7.64e1 SMART
Blast:WD40 686 742 1e-13 BLAST
WD40 745 784 8.62e-4 SMART
WD40 789 827 1.19e1 SMART
WD40 832 871 5.97e-1 SMART
WD40 880 923 1.23e2 SMART
WD40 1030 1070 1.15e0 SMART
low complexity region 1274 1285 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143629
Predicted Effect possibly damaging
Transcript: ENSMUST00000163092
AA Change: V124A

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126995
Gene: ENSMUSG00000029442
AA Change: V124A

DomainStartEndE-ValueType
Blast:WD40 1 28 3e-10 BLAST
Blast:WD40 35 75 2e-15 BLAST
Blast:WD40 87 126 3e-17 BLAST
low complexity region 130 144 N/A INTRINSIC
WD40 146 180 7.64e1 SMART
Blast:WD40 183 246 2e-14 BLAST
WD40 248 287 8.62e-4 SMART
WD40 292 330 1.19e1 SMART
WD40 335 374 5.97e-1 SMART
WD40 383 426 1.23e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170536
AA Change: V182A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129769
Gene: ENSMUSG00000029442
AA Change: V182A

DomainStartEndE-ValueType
WD40 42 86 3.18e1 SMART
Blast:WD40 93 133 1e-15 BLAST
Blast:WD40 145 184 3e-17 BLAST
low complexity region 188 202 N/A INTRINSIC
WD40 204 238 7.64e1 SMART
Blast:WD40 241 304 3e-14 BLAST
WD40 306 345 8.62e-4 SMART
WD40 350 388 1.19e1 SMART
WD40 393 432 5.97e-1 SMART
WD40 441 484 1.23e2 SMART
Blast:WD40 490 535 2e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200666
Meta Mutation Damage Score 0.1414 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.5%
Validation Efficiency 95% (76/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member appears to function in the determination of mean platelet volume (MPV), and polymorphisms in this gene have been associated with variance in MPV. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,086,039 F488S probably damaging Het
Acap3 C T 4: 155,899,424 R116W probably damaging Het
Adamts10 C A 17: 33,545,390 P663T possibly damaging Het
Akap12 G A 10: 4,353,333 G48S probably damaging Het
Ankrd7 T A 6: 18,870,031 M261K probably benign Het
Ankzf1 C A 1: 75,198,304 D599E possibly damaging Het
Aox1 T C 1: 58,105,014 I1278T possibly damaging Het
Apcdd1 T C 18: 62,950,079 Y327H probably benign Het
Asxl3 T A 18: 22,411,496 probably benign Het
Birc6 C A 17: 74,662,832 probably benign Het
Btaf1 T A 19: 37,009,648 L1714* probably null Het
Cacng6 T A 7: 3,425,004 probably benign Het
Cdc20b A G 13: 113,078,612 D238G probably damaging Het
Celf5 T A 10: 81,470,698 R113W probably null Het
Cfap70 C A 14: 20,412,347 E659D probably damaging Het
Clspn T A 4: 126,590,598 M1183K possibly damaging Het
Dpy19l1 G A 9: 24,453,891 R275C probably damaging Het
Dst C T 1: 34,186,935 S1721L probably benign Het
Faap100 T C 11: 120,374,365 T562A probably damaging Het
Fam168b T C 1: 34,819,688 M133V probably damaging Het
Farp2 T C 1: 93,569,087 I172T probably damaging Het
Fer T G 17: 63,896,278 S68A probably damaging Het
Fmo5 A G 3: 97,645,681 E315G probably damaging Het
Gpr89 A T 3: 96,871,480 F426I probably damaging Het
Hinfp T C 9: 44,296,327 I461V possibly damaging Het
Hsd11b1 A T 1: 193,240,248 V167D probably damaging Het
Htt A G 5: 34,896,908 K2574E probably benign Het
I830077J02Rik A G 3: 105,926,505 S112P probably benign Het
Igf2bp3 T A 6: 49,105,617 M344L probably benign Het
Itch A T 2: 155,202,257 Q494L probably benign Het
Itga9 T C 9: 118,769,253 probably benign Het
Jaml T A 9: 45,093,767 D152E probably benign Het
Kif22 A C 7: 127,042,400 M1R probably null Het
Kifap3 T C 1: 163,883,386 Y663H probably benign Het
Letm2 T A 8: 25,578,770 N472I probably damaging Het
Mthfr T G 4: 148,052,224 V446G probably damaging Het
Myh11 T C 16: 14,211,260 E1206G possibly damaging Het
Myo6 G A 9: 80,288,056 V903I probably damaging Het
Myo9b C T 8: 71,355,225 probably benign Het
Nr2f2 G C 7: 70,360,175 P52R probably damaging Het
Nsd3 A G 8: 25,683,257 N859S probably benign Het
Nucb2 C A 7: 116,536,010 A384E probably damaging Het
Ogdhl C A 14: 32,342,037 probably null Het
Olfr119 C A 17: 37,701,058 C129* probably null Het
Olfr1247 G A 2: 89,609,863 L80F probably damaging Het
Olfr1357 T C 10: 78,611,871 T257A probably benign Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr381 A T 11: 73,486,575 L83Q probably benign Het
Parp10 C T 15: 76,242,633 S145N probably benign Het
Pigh A G 12: 79,083,709 probably benign Het
Pigo A G 4: 43,023,824 probably benign Het
Pkp4 T A 2: 59,305,488 V199D possibly damaging Het
Polr1e C A 4: 45,025,143 probably null Het
Ppfia3 C A 7: 45,348,534 R723L probably damaging Het
Prex1 C A 2: 166,585,898 A945S possibly damaging Het
Prrt3 A T 6: 113,495,840 V457E probably damaging Het
Rab39 A G 9: 53,705,971 F49L possibly damaging Het
Rrs1 C A 1: 9,545,762 probably null Het
Rrs1 G A 1: 9,545,767 E82K probably damaging Het
Serpinb3c T C 1: 107,276,992 D8G probably benign Het
Slc17a6 A G 7: 51,646,180 probably benign Het
Slc24a4 T A 12: 102,228,951 probably null Het
Smc1b C T 15: 85,123,759 M272I probably benign Het
Smc6 T C 12: 11,283,178 probably benign Het
Tcf20 T C 15: 82,855,085 T722A probably benign Het
Tesmin A T 19: 3,404,088 M141L probably benign Het
Tmprss5 T A 9: 49,113,160 H274Q possibly damaging Het
Tns1 C T 1: 73,937,318 probably null Het
Tpr T C 1: 150,417,427 S868P possibly damaging Het
Trank1 C T 9: 111,366,253 T1115I probably damaging Het
Trmt44 A T 5: 35,572,917 I203K possibly damaging Het
Ulk2 A T 11: 61,777,785 V1037E probably benign Het
Usp43 A G 11: 67,876,499 Y682H probably damaging Het
Vipr2 A T 12: 116,142,882 Q366L probably damaging Het
Vmn1r185 C A 7: 26,611,589 V164L possibly damaging Het
Vmn2r120 C T 17: 57,525,052 V246I probably benign Het
Wiz C T 17: 32,357,033 G790R probably damaging Het
Wnk1 A T 6: 119,952,733 S1016R probably damaging Het
Zc3hav1 A G 6: 38,311,174 L909S probably benign Het
Zfp236 T A 18: 82,640,227 I637F probably damaging Het
Zfp788 G A 7: 41,649,596 G532D probably damaging Het
Zranb1 T C 7: 132,950,385 I255T probably damaging Het
Other mutations in Wdr66
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Wdr66 APN 5 123274177 missense probably damaging 1.00
IGL01090:Wdr66 APN 5 123279989 splice site probably benign
IGL01387:Wdr66 APN 5 123283546 missense probably damaging 1.00
IGL01432:Wdr66 APN 5 123279952 missense possibly damaging 0.88
IGL01642:Wdr66 APN 5 123288698 missense possibly damaging 0.77
IGL01720:Wdr66 APN 5 123322494 missense probably benign 0.07
IGL02104:Wdr66 APN 5 123302698 nonsense probably null
IGL02160:Wdr66 APN 5 123256018 missense unknown
IGL02238:Wdr66 APN 5 123302423 missense probably damaging 1.00
IGL02820:Wdr66 APN 5 123254636 unclassified probably benign
IGL03183:Wdr66 APN 5 123254619 unclassified probably benign
R0078:Wdr66 UTSW 5 123298570 missense probably benign 0.04
R0411:Wdr66 UTSW 5 123290054 missense probably damaging 1.00
R0414:Wdr66 UTSW 5 123287413 splice site probably null
R0722:Wdr66 UTSW 5 123256185 missense probably damaging 1.00
R1169:Wdr66 UTSW 5 123254610 small deletion probably benign
R1527:Wdr66 UTSW 5 123287345 missense probably benign 0.19
R1924:Wdr66 UTSW 5 123302739 missense possibly damaging 0.67
R2022:Wdr66 UTSW 5 123273790 missense probably benign 0.29
R2110:Wdr66 UTSW 5 123254375 unclassified probably benign
R2112:Wdr66 UTSW 5 123254375 unclassified probably benign
R2147:Wdr66 UTSW 5 123256191 missense probably benign 0.01
R2258:Wdr66 UTSW 5 123283348 splice site probably null
R2407:Wdr66 UTSW 5 123289969 missense probably benign 0.11
R2418:Wdr66 UTSW 5 123254268 unclassified probably benign
R2497:Wdr66 UTSW 5 123283369 missense probably damaging 1.00
R2509:Wdr66 UTSW 5 123256106 missense probably benign 0.00
R3437:Wdr66 UTSW 5 123254372 unclassified probably benign
R3730:Wdr66 UTSW 5 123326568 missense possibly damaging 0.70
R3800:Wdr66 UTSW 5 123254721 unclassified probably benign
R4018:Wdr66 UTSW 5 123322454 missense probably benign 0.04
R4181:Wdr66 UTSW 5 123293810 missense probably benign 0.33
R4302:Wdr66 UTSW 5 123293810 missense probably benign 0.33
R4640:Wdr66 UTSW 5 123302432 missense probably benign 0.00
R4701:Wdr66 UTSW 5 123322613 missense probably benign 0.00
R4799:Wdr66 UTSW 5 123302772 missense probably benign 0.04
R4812:Wdr66 UTSW 5 123287305 missense probably benign 0.01
R4922:Wdr66 UTSW 5 123256053 missense probably benign 0.00
R5123:Wdr66 UTSW 5 123273633 start gained probably benign
R5314:Wdr66 UTSW 5 123322563 missense probably benign 0.01
R5445:Wdr66 UTSW 5 123287177 missense probably damaging 1.00
R5458:Wdr66 UTSW 5 123254445 unclassified probably benign
R5462:Wdr66 UTSW 5 123298632 critical splice donor site probably null
R5514:Wdr66 UTSW 5 123287766 critical splice donor site probably null
R5600:Wdr66 UTSW 5 123288698 missense possibly damaging 0.77
R5635:Wdr66 UTSW 5 123322572 missense probably benign 0.25
R5767:Wdr66 UTSW 5 123298521 missense probably benign 0.01
R5943:Wdr66 UTSW 5 123286357 missense probably benign 0.13
R6000:Wdr66 UTSW 5 123254372 unclassified probably benign
R6030:Wdr66 UTSW 5 123274204 missense probably damaging 0.97
R6030:Wdr66 UTSW 5 123274204 missense probably damaging 0.97
R6293:Wdr66 UTSW 5 123322448 missense probably damaging 1.00
R6354:Wdr66 UTSW 5 123302755 missense probably damaging 0.99
R6356:Wdr66 UTSW 5 123254666 unclassified probably benign
R6427:Wdr66 UTSW 5 123326533 missense probably damaging 1.00
R6896:Wdr66 UTSW 5 123278358 missense possibly damaging 0.81
R6909:Wdr66 UTSW 5 123287752 missense probably damaging 1.00
R7503:Wdr66 UTSW 5 123297458 nonsense probably null
R7707:Wdr66 UTSW 5 123253887 missense probably benign 0.00
R7715:Wdr66 UTSW 5 123262134 missense probably damaging 1.00
R7809:Wdr66 UTSW 5 123264831 missense probably damaging 1.00
R7819:Wdr66 UTSW 5 123254259 unclassified probably benign
R7842:Wdr66 UTSW 5 123254424 missense unknown
R7898:Wdr66 UTSW 5 123322454 missense probably damaging 0.99
R7925:Wdr66 UTSW 5 123254424 missense unknown
R7981:Wdr66 UTSW 5 123322454 missense probably damaging 0.99
R8004:Wdr66 UTSW 5 123254450 missense unknown
R8068:Wdr66 UTSW 5 123256166 missense not run
RF007:Wdr66 UTSW 5 123254254 small insertion probably benign
RF010:Wdr66 UTSW 5 123274161 critical splice acceptor site probably benign
RF015:Wdr66 UTSW 5 123254242 small insertion probably benign
RF015:Wdr66 UTSW 5 123274161 critical splice acceptor site probably benign
RF017:Wdr66 UTSW 5 123253890 small insertion probably benign
RF024:Wdr66 UTSW 5 123253883 small insertion probably benign
RF024:Wdr66 UTSW 5 123253888 small insertion probably benign
RF024:Wdr66 UTSW 5 123253889 small insertion probably benign
X0062:Wdr66 UTSW 5 123274237 missense probably benign 0.29
X0066:Wdr66 UTSW 5 123288647 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGCCACACAGATACATGTTTTGGTTCT -3'
(R):5'- TGCCCGTGGTCAATTACAACTCTC -3'

Sequencing Primer
(F):5'- CATGTTTTGGTTCTATTAGCATCATC -3'
(R):5'- aaacacacacacacacacac -3'
Posted On2013-05-09