Incidental Mutation 'R4547:Slc8a3'
ID 333834
Institutional Source Beutler Lab
Gene Symbol Slc8a3
Ensembl Gene ENSMUSG00000079055
Gene Name solute carrier family 8 (sodium/calcium exchanger), member 3
Synonyms Ncx3
MMRRC Submission 041781-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4547 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 81244689-81379954 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 81361625 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 398 (V398A)
Ref Sequence ENSEMBL: ENSMUSP00000063258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064594] [ENSMUST00000085238] [ENSMUST00000182208]
AlphaFold S4R2P9
Predicted Effect possibly damaging
Transcript: ENSMUST00000064594
AA Change: V398A

PolyPhen 2 Score 0.756 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000063258
Gene: ENSMUSG00000079055
AA Change: V398A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 79 250 1.3e-36 PFAM
Pfam:Na_Ca_ex_C 253 379 4.6e-57 PFAM
Calx_beta 385 485 3.25e-42 SMART
Calx_beta 519 619 1.04e-40 SMART
low complexity region 712 723 N/A INTRINSIC
Pfam:Na_Ca_ex 754 919 2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085238
AA Change: V398A

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000082334
Gene: ENSMUSG00000079055
AA Change: V398A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 79 250 1.3e-36 PFAM
Pfam:Na_Ca_ex_C 253 379 4.6e-57 PFAM
Calx_beta 385 485 3.25e-42 SMART
Calx_beta 519 619 1.54e-43 SMART
low complexity region 705 716 N/A INTRINSIC
Pfam:Na_Ca_ex 747 912 1.9e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182208
AA Change: V398A

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000138735
Gene: ENSMUSG00000079055
AA Change: V398A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 89 248 8.1e-38 PFAM
Calx_beta 385 485 3.25e-42 SMART
Calx_beta 519 619 1.04e-40 SMART
low complexity region 712 723 N/A INTRINSIC
Pfam:Na_Ca_ex 764 917 9.1e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183102
Meta Mutation Damage Score 0.2523 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium/calcium exchanger integral membrane protein family. Na+/Ca2+ exchange proteins are involved in maintaining Ca2+ homeostasis in a wide variety of cell types. The protein is regulated by intracellular calcium ions and is found in both the plasma membrane and intracellular organellar membranes, where exchange of Na+ for Ca2+ occurs in an electrogenic manner. Alternative splicing has been observed for this gene and multiple variants have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 G T 14: 54,883,124 (GRCm39) A909E probably benign Het
Ankrd13a A G 5: 114,913,357 (GRCm39) E23G probably benign Het
Ano4 T C 10: 88,817,032 (GRCm39) R148G probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 117,721,122 (GRCm39) probably benign Het
Aspm T C 1: 139,405,925 (GRCm39) V1604A possibly damaging Het
Cdh1 C A 8: 107,390,535 (GRCm39) T625K probably damaging Het
Cfap65 G A 1: 74,946,771 (GRCm39) T1313I probably damaging Het
Cfhr3 T G 1: 139,512,651 (GRCm39) noncoding transcript Het
Csmd1 T C 8: 16,441,811 (GRCm39) D351G possibly damaging Het
Dis3l2 A T 1: 86,977,393 (GRCm39) T861S probably benign Het
Dnah6 A T 6: 73,169,388 (GRCm39) D404E probably benign Het
Dpm1 A G 2: 168,065,073 (GRCm39) L88P probably damaging Het
Fabp3 C T 4: 130,206,245 (GRCm39) probably null Het
Fat4 T C 3: 39,005,432 (GRCm39) F1944L probably damaging Het
Frmd4a C A 2: 4,477,956 (GRCm39) L46I probably damaging Het
Gpr39 G A 1: 125,605,728 (GRCm39) V219I probably benign Het
Hace1 T A 10: 45,548,651 (GRCm39) probably null Het
Kdm1b C T 13: 47,216,553 (GRCm39) R308W probably damaging Het
Klb T A 5: 65,537,271 (GRCm39) V867E probably benign Het
Lnpk C G 2: 74,352,630 (GRCm39) E351Q probably benign Het
Mettl25 T C 10: 105,661,878 (GRCm39) D364G probably damaging Het
Mrc2 G A 11: 105,227,467 (GRCm39) V567I probably benign Het
Mrm2 T C 5: 140,314,251 (GRCm39) T195A probably benign Het
Naaa C T 5: 92,411,445 (GRCm39) probably null Het
Ncdn A G 4: 126,640,467 (GRCm39) F542S probably damaging Het
Nlrp4e A G 7: 23,036,291 (GRCm39) N715D probably benign Het
Nup42 T C 5: 24,382,968 (GRCm39) probably benign Het
Or10ag57 G A 2: 87,218,504 (GRCm39) V152I probably benign Het
Or2t6 A T 14: 14,175,854 (GRCm38) I76N probably damaging Het
Psg25 A G 7: 18,258,629 (GRCm39) L349P probably damaging Het
Rnf213 G T 11: 119,370,496 (GRCm39) probably null Het
Scara5 A C 14: 65,908,023 (GRCm39) K4N possibly damaging Het
Slc35f5 T C 1: 125,500,119 (GRCm39) L211S probably benign Het
Slc44a4 T A 17: 35,146,731 (GRCm39) F285I probably damaging Het
Smc2 T C 4: 52,467,866 (GRCm39) S737P probably benign Het
Speer2 T C 16: 69,655,737 (GRCm39) K30E probably damaging Het
Synj1 T C 16: 90,785,170 (GRCm39) I229V possibly damaging Het
Tac1 A G 6: 7,557,216 (GRCm39) D74G probably damaging Het
Tbc1d17 A G 7: 44,490,771 (GRCm39) V607A probably benign Het
Tmem132a A G 19: 10,837,564 (GRCm39) V582A possibly damaging Het
Traf4 A G 11: 78,051,863 (GRCm39) I207T possibly damaging Het
Trio T C 15: 27,819,068 (GRCm39) R449G possibly damaging Het
Ubn1 G A 16: 4,889,956 (GRCm39) R407H probably damaging Het
Vmn1r19 C T 6: 57,381,774 (GRCm39) T109I possibly damaging Het
Vmn2r60 A G 7: 41,785,087 (GRCm39) T100A probably null Het
Vsig8 A T 1: 172,388,163 (GRCm39) M44L probably benign Het
Zbed5 T A 5: 129,931,692 (GRCm39) L547* probably null Het
Other mutations in Slc8a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Slc8a3 APN 12 81,361,343 (GRCm39) missense probably benign
IGL01315:Slc8a3 APN 12 81,361,169 (GRCm39) missense probably damaging 0.97
IGL01365:Slc8a3 APN 12 81,362,150 (GRCm39) missense probably damaging 0.99
IGL01610:Slc8a3 APN 12 81,362,576 (GRCm39) missense probably damaging 1.00
IGL02227:Slc8a3 APN 12 81,362,457 (GRCm39) missense probably damaging 1.00
IGL02299:Slc8a3 APN 12 81,361,998 (GRCm39) missense probably damaging 0.98
IGL02548:Slc8a3 APN 12 81,250,930 (GRCm39) splice site probably benign
IGL02646:Slc8a3 APN 12 81,361,868 (GRCm39) missense probably damaging 1.00
IGL03135:Slc8a3 APN 12 81,249,023 (GRCm39) missense probably damaging 1.00
R0050:Slc8a3 UTSW 12 81,362,039 (GRCm39) missense probably damaging 1.00
R0627:Slc8a3 UTSW 12 81,361,616 (GRCm39) missense probably damaging 1.00
R0648:Slc8a3 UTSW 12 81,361,220 (GRCm39) missense probably damaging 1.00
R1342:Slc8a3 UTSW 12 81,362,790 (GRCm39) missense probably damaging 0.99
R1437:Slc8a3 UTSW 12 81,362,760 (GRCm39) missense probably damaging 0.99
R1470:Slc8a3 UTSW 12 81,246,484 (GRCm39) missense probably benign
R1470:Slc8a3 UTSW 12 81,246,484 (GRCm39) missense probably benign
R1557:Slc8a3 UTSW 12 81,362,331 (GRCm39) missense probably damaging 1.00
R1563:Slc8a3 UTSW 12 81,251,781 (GRCm39) missense possibly damaging 0.47
R1918:Slc8a3 UTSW 12 81,361,618 (GRCm39) missense probably damaging 0.99
R1930:Slc8a3 UTSW 12 81,361,220 (GRCm39) missense probably damaging 1.00
R1931:Slc8a3 UTSW 12 81,361,220 (GRCm39) missense probably damaging 1.00
R2232:Slc8a3 UTSW 12 81,361,994 (GRCm39) missense probably damaging 0.99
R2680:Slc8a3 UTSW 12 81,249,113 (GRCm39) missense probably damaging 0.99
R2941:Slc8a3 UTSW 12 81,361,953 (GRCm39) missense probably damaging 1.00
R3157:Slc8a3 UTSW 12 81,361,766 (GRCm39) missense probably damaging 1.00
R3159:Slc8a3 UTSW 12 81,361,766 (GRCm39) missense probably damaging 1.00
R3751:Slc8a3 UTSW 12 81,250,912 (GRCm39) missense probably damaging 1.00
R3859:Slc8a3 UTSW 12 81,361,646 (GRCm39) missense probably damaging 0.99
R4240:Slc8a3 UTSW 12 81,361,950 (GRCm39) missense probably damaging 0.99
R4527:Slc8a3 UTSW 12 81,362,627 (GRCm39) missense probably damaging 1.00
R4951:Slc8a3 UTSW 12 81,362,760 (GRCm39) missense probably damaging 0.99
R4951:Slc8a3 UTSW 12 81,361,473 (GRCm39) missense probably benign 0.31
R5022:Slc8a3 UTSW 12 81,246,332 (GRCm39) missense probably damaging 0.96
R5049:Slc8a3 UTSW 12 81,260,906 (GRCm39) missense probably damaging 1.00
R5057:Slc8a3 UTSW 12 81,246,332 (GRCm39) missense probably damaging 0.96
R5104:Slc8a3 UTSW 12 81,260,908 (GRCm39) missense probably null 0.34
R5122:Slc8a3 UTSW 12 81,361,032 (GRCm39) critical splice donor site probably null
R5183:Slc8a3 UTSW 12 81,361,265 (GRCm39) missense possibly damaging 0.79
R5629:Slc8a3 UTSW 12 81,246,405 (GRCm39) missense probably damaging 1.00
R6062:Slc8a3 UTSW 12 81,361,124 (GRCm39) missense probably damaging 1.00
R6218:Slc8a3 UTSW 12 81,246,341 (GRCm39) missense probably benign
R6279:Slc8a3 UTSW 12 81,361,752 (GRCm39) missense probably damaging 0.99
R6300:Slc8a3 UTSW 12 81,361,752 (GRCm39) missense probably damaging 0.99
R6416:Slc8a3 UTSW 12 81,362,401 (GRCm39) missense probably damaging 1.00
R6790:Slc8a3 UTSW 12 81,361,206 (GRCm39) missense probably benign 0.00
R6999:Slc8a3 UTSW 12 81,361,529 (GRCm39) missense probably benign 0.06
R7195:Slc8a3 UTSW 12 81,361,047 (GRCm39) missense possibly damaging 0.95
R7268:Slc8a3 UTSW 12 81,361,827 (GRCm39) missense probably damaging 0.98
R7288:Slc8a3 UTSW 12 81,263,598 (GRCm39) missense possibly damaging 0.70
R7383:Slc8a3 UTSW 12 81,362,579 (GRCm39) missense probably damaging 1.00
R7392:Slc8a3 UTSW 12 81,361,577 (GRCm39) missense probably damaging 0.99
R7394:Slc8a3 UTSW 12 81,260,832 (GRCm39) splice site probably null
R7549:Slc8a3 UTSW 12 81,361,544 (GRCm39) missense probably benign 0.06
R7657:Slc8a3 UTSW 12 81,361,158 (GRCm39) missense probably damaging 1.00
R7699:Slc8a3 UTSW 12 81,361,247 (GRCm39) missense probably damaging 1.00
R7759:Slc8a3 UTSW 12 81,361,325 (GRCm39) missense probably benign
R7960:Slc8a3 UTSW 12 81,263,506 (GRCm39) missense probably benign 0.00
R7985:Slc8a3 UTSW 12 81,361,767 (GRCm39) missense probably damaging 1.00
R8059:Slc8a3 UTSW 12 81,249,032 (GRCm39) missense probably damaging 1.00
R8192:Slc8a3 UTSW 12 81,246,455 (GRCm39) missense probably damaging 1.00
R8397:Slc8a3 UTSW 12 81,246,542 (GRCm39) missense probably benign 0.45
R8413:Slc8a3 UTSW 12 81,361,452 (GRCm39) missense probably damaging 0.97
R8681:Slc8a3 UTSW 12 81,361,914 (GRCm39) missense probably benign
R9060:Slc8a3 UTSW 12 81,260,852 (GRCm39) missense probably benign 0.45
R9061:Slc8a3 UTSW 12 81,263,540 (GRCm39) missense probably damaging 0.99
R9267:Slc8a3 UTSW 12 81,361,208 (GRCm39) missense possibly damaging 0.77
R9416:Slc8a3 UTSW 12 81,361,838 (GRCm39) missense probably benign 0.06
R9519:Slc8a3 UTSW 12 81,362,326 (GRCm39) missense probably benign 0.30
R9531:Slc8a3 UTSW 12 81,361,997 (GRCm39) missense probably damaging 1.00
X0026:Slc8a3 UTSW 12 81,362,061 (GRCm39) missense probably benign 0.22
X0028:Slc8a3 UTSW 12 81,361,717 (GRCm39) missense probably damaging 1.00
Z1177:Slc8a3 UTSW 12 81,362,650 (GRCm39) missense probably benign 0.13
Z1177:Slc8a3 UTSW 12 81,361,474 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGCCCACAGAGAACTCCTTC -3'
(R):5'- GCTGGTGGAGATGGCCAATTAC -3'

Sequencing Primer
(F):5'- ACAGAGAACTCCTTCTGGGTC -3'
(R):5'- GGAGATGGCCAATTACTATGCTC -3'
Posted On 2015-08-18