Mutagenetix > Incidental Mutation

Incidental Mutation 'R4547:Slc8a3'

333834

Institutional Source

Beutler Lab

Gene Symbol

Slc8a3

Ensembl Gene

ENSMUSG00000079055

Gene Name

solute carrier family 8 (sodium/calcium exchanger), member 3

Synonyms

Ncx3

MMRRC Submission

041781-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4547 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

81197915-81333180 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 81314851 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 398 (V398A)

Ref Sequence

ENSEMBL: ENSMUSP00000063258 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064594] [ENSMUST00000085238] [ENSMUST00000182208]

AlphaFold

S4R2P9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000064594
AA Change: V398A

PolyPhen 2 Score 0.756 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000063258
Gene: ENSMUSG00000079055
AA Change: V398A

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	79	250	1.3e-36	PFAM
Pfam:Na_Ca_ex_C	253	379	4.6e-57	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.04e-40	SMART
low complexity region	712	723	N/A	INTRINSIC
Pfam:Na_Ca_ex	754	919	2e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000085238
AA Change: V398A

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000082334
Gene: ENSMUSG00000079055
AA Change: V398A

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	79	250	1.3e-36	PFAM
Pfam:Na_Ca_ex_C	253	379	4.6e-57	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.54e-43	SMART
low complexity region	705	716	N/A	INTRINSIC
Pfam:Na_Ca_ex	747	912	1.9e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000182208
AA Change: V398A

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000138735
Gene: ENSMUSG00000079055
AA Change: V398A

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	89	248	8.1e-38	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.04e-40	SMART
low complexity region	712	723	N/A	INTRINSIC
Pfam:Na_Ca_ex	764	917	9.1e-27	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183102

Meta Mutation Damage Score

0.2523

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

96% (55/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium/calcium exchanger integral membrane protein family. Na+/Ca2+ exchange proteins are involved in maintaining Ca2+ homeostasis in a wide variety of cell types. The protein is regulated by intracellular calcium ions and is found in both the plasma membrane and intracellular organellar membranes, where exchange of Na+ for Ca2+ occurs in an electrogenic manner. Alternative splicing has been observed for this gene and multiple variants have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acin1	G	T	14: 54,645,667	A909E	probably benign	Het
Ankrd13a	A	G	5: 114,775,296	E23G	probably benign	Het
Ano4	T	C	10: 88,981,170	R148G	probably null	Het
Arl6ip1	AAAATAAATAAATAAATAAATAAATA	AAAATAAATAAATAAATAAATAAATAAATA	7: 118,121,899		probably benign	Het
Aspm	T	C	1: 139,478,187	V1604A	possibly damaging	Het
Cdh1	C	A	8: 106,663,903	T625K	probably damaging	Het
Cfap65	G	A	1: 74,907,612	T1313I	probably damaging	Het
Cfhr3	T	G	1: 139,584,913		noncoding transcript	Het
Csmd1	T	C	8: 16,391,797	D351G	possibly damaging	Het
Dis3l2	A	T	1: 87,049,671	T861S	probably benign	Het
Dnah6	A	T	6: 73,192,405	D404E	probably benign	Het
Dpm1	A	G	2: 168,223,153	L88P	probably damaging	Het
Fabp3	C	T	4: 130,312,452		probably null	Het
Fat4	T	C	3: 38,951,283	F1944L	probably damaging	Het
Frmd4a	C	A	2: 4,473,145	L46I	probably damaging	Het
Gpr39	G	A	1: 125,677,991	V219I	probably benign	Het
Hace1	T	A	10: 45,672,555		probably null	Het
Kdm1b	C	T	13: 47,063,077	R308W	probably damaging	Het
Klb	T	A	5: 65,379,928	V867E	probably benign	Het
Lnpk	C	G	2: 74,522,286	E351Q	probably benign	Het
Mettl25	T	C	10: 105,826,017	D364G	probably damaging	Het
Mrc2	G	A	11: 105,336,641	V567I	probably benign	Het
Mrm2	T	C	5: 140,328,496	T195A	probably benign	Het
Naaa	C	T	5: 92,263,586		probably null	Het
Ncdn	A	G	4: 126,746,674	F542S	probably damaging	Het
Nlrp4e	A	G	7: 23,336,866	N715D	probably benign	Het
Nupl2	T	C	5: 24,177,970		probably benign	Het
Olfr1122	G	A	2: 87,388,160	V152I	probably benign	Het
Olfr720	A	T	14: 14,175,854	I76N	probably damaging	Het
Psg25	A	G	7: 18,524,704	L349P	probably damaging	Het
Rnf213	G	T	11: 119,479,670		probably null	Het
Scara5	A	C	14: 65,670,574	K4N	possibly damaging	Het
Slc35f5	T	C	1: 125,572,382	L211S	probably benign	Het
Slc44a4	T	A	17: 34,927,755	F285I	probably damaging	Het
Smc2	T	C	4: 52,467,866	S737P	probably benign	Het
Speer2	T	C	16: 69,858,849	K30E	probably damaging	Het
Synj1	T	C	16: 90,988,282	I229V	possibly damaging	Het
Tac1	A	G	6: 7,557,216	D74G	probably damaging	Het
Tbc1d17	A	G	7: 44,841,347	V607A	probably benign	Het
Tmem132a	A	G	19: 10,860,200	V582A	possibly damaging	Het
Traf4	A	G	11: 78,161,037	I207T	possibly damaging	Het
Trio	T	C	15: 27,818,982	R449G	possibly damaging	Het
Ubn1	G	A	16: 5,072,092	R407H	probably damaging	Het
Vmn1r19	C	T	6: 57,404,789	T109I	possibly damaging	Het
Vmn2r60	A	G	7: 42,135,663	T100A	probably null	Het
Vsig8	A	T	1: 172,560,596	M44L	probably benign	Het
Zbed5	T	A	5: 129,902,851	L547*	probably null	Het

Other mutations in Slc8a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:Slc8a3	APN	12	81314569	missense	probably benign
IGL01315:Slc8a3	APN	12	81314395	missense	probably damaging	0.97
IGL01365:Slc8a3	APN	12	81315376	missense	probably damaging	0.99
IGL01610:Slc8a3	APN	12	81315802	missense	probably damaging	1.00
IGL02227:Slc8a3	APN	12	81315683	missense	probably damaging	1.00
IGL02299:Slc8a3	APN	12	81315224	missense	probably damaging	0.98
IGL02548:Slc8a3	APN	12	81204156	splice site	probably benign
IGL02646:Slc8a3	APN	12	81315094	missense	probably damaging	1.00
IGL03135:Slc8a3	APN	12	81202249	missense	probably damaging	1.00
R0050:Slc8a3	UTSW	12	81315265	missense	probably damaging	1.00
R0627:Slc8a3	UTSW	12	81314842	missense	probably damaging	1.00
R0648:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R1342:Slc8a3	UTSW	12	81316016	missense	probably damaging	0.99
R1437:Slc8a3	UTSW	12	81315986	missense	probably damaging	0.99
R1470:Slc8a3	UTSW	12	81199710	missense	probably benign
R1470:Slc8a3	UTSW	12	81199710	missense	probably benign
R1557:Slc8a3	UTSW	12	81315557	missense	probably damaging	1.00
R1563:Slc8a3	UTSW	12	81205007	missense	possibly damaging	0.47
R1918:Slc8a3	UTSW	12	81314844	missense	probably damaging	0.99
R1930:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R1931:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R2232:Slc8a3	UTSW	12	81315220	missense	probably damaging	0.99
R2680:Slc8a3	UTSW	12	81202339	missense	probably damaging	0.99
R2941:Slc8a3	UTSW	12	81315179	missense	probably damaging	1.00
R3157:Slc8a3	UTSW	12	81314992	missense	probably damaging	1.00
R3159:Slc8a3	UTSW	12	81314992	missense	probably damaging	1.00
R3751:Slc8a3	UTSW	12	81204138	missense	probably damaging	1.00
R3859:Slc8a3	UTSW	12	81314872	missense	probably damaging	0.99
R4240:Slc8a3	UTSW	12	81315176	missense	probably damaging	0.99
R4527:Slc8a3	UTSW	12	81315853	missense	probably damaging	1.00
R4951:Slc8a3	UTSW	12	81314699	missense	probably benign	0.31
R4951:Slc8a3	UTSW	12	81315986	missense	probably damaging	0.99
R5022:Slc8a3	UTSW	12	81199558	missense	probably damaging	0.96
R5049:Slc8a3	UTSW	12	81214132	missense	probably damaging	1.00
R5057:Slc8a3	UTSW	12	81199558	missense	probably damaging	0.96
R5104:Slc8a3	UTSW	12	81214134	missense	probably null	0.34
R5122:Slc8a3	UTSW	12	81314258	critical splice donor site	probably null
R5183:Slc8a3	UTSW	12	81314491	missense	possibly damaging	0.79
R5629:Slc8a3	UTSW	12	81199631	missense	probably damaging	1.00
R6062:Slc8a3	UTSW	12	81314350	missense	probably damaging	1.00
R6218:Slc8a3	UTSW	12	81199567	missense	probably benign
R6279:Slc8a3	UTSW	12	81314978	missense	probably damaging	0.99
R6300:Slc8a3	UTSW	12	81314978	missense	probably damaging	0.99
R6416:Slc8a3	UTSW	12	81315627	missense	probably damaging	1.00
R6790:Slc8a3	UTSW	12	81314432	missense	probably benign	0.00
R6999:Slc8a3	UTSW	12	81314755	missense	probably benign	0.06
R7195:Slc8a3	UTSW	12	81314273	missense	possibly damaging	0.95
R7268:Slc8a3	UTSW	12	81315053	missense	probably damaging	0.98
R7288:Slc8a3	UTSW	12	81216824	missense	possibly damaging	0.70
R7383:Slc8a3	UTSW	12	81315805	missense	probably damaging	1.00
R7392:Slc8a3	UTSW	12	81314803	missense	probably damaging	0.99
R7394:Slc8a3	UTSW	12	81214058	splice site	probably null
R7549:Slc8a3	UTSW	12	81314770	missense	probably benign	0.06
R7657:Slc8a3	UTSW	12	81314384	missense	probably damaging	1.00
R7699:Slc8a3	UTSW	12	81314473	missense	probably damaging	1.00
R7759:Slc8a3	UTSW	12	81314551	missense	probably benign
R7960:Slc8a3	UTSW	12	81216732	missense	probably benign	0.00
R7985:Slc8a3	UTSW	12	81314993	missense	probably damaging	1.00
R8059:Slc8a3	UTSW	12	81202258	missense	probably damaging	1.00
R8192:Slc8a3	UTSW	12	81199681	missense	probably damaging	1.00
R8397:Slc8a3	UTSW	12	81199768	missense	probably benign	0.45
R8413:Slc8a3	UTSW	12	81314678	missense	probably damaging	0.97
R8681:Slc8a3	UTSW	12	81315140	missense	probably benign
R9060:Slc8a3	UTSW	12	81214078	missense	probably benign	0.45
R9061:Slc8a3	UTSW	12	81216766	missense	probably damaging	0.99
R9267:Slc8a3	UTSW	12	81314434	missense	possibly damaging	0.77
R9416:Slc8a3	UTSW	12	81315064	missense	probably benign	0.06
R9519:Slc8a3	UTSW	12	81315552	missense	probably benign	0.30
R9531:Slc8a3	UTSW	12	81315223	missense	probably damaging	1.00
X0026:Slc8a3	UTSW	12	81315287	missense	probably benign	0.22
X0028:Slc8a3	UTSW	12	81314943	missense	probably damaging	1.00
Z1177:Slc8a3	UTSW	12	81314700	missense	possibly damaging	0.92
Z1177:Slc8a3	UTSW	12	81315876	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- TGCCCACAGAGAACTCCTTC -3'
(R):5'- GCTGGTGGAGATGGCCAATTAC -3'

Sequencing Primer
(F):5'- ACAGAGAACTCCTTCTGGGTC -3'
(R):5'- GGAGATGGCCAATTACTATGCTC -3'

Posted On

2015-08-18