Incidental Mutation 'R4547:Olfr720'
ID333836
Institutional Source Beutler Lab
Gene Symbol Olfr720
Ensembl Gene ENSMUSG00000052417
Gene Nameolfactory receptor 720
SynonymsMOR274-2, GA_x6K02T2PLTE-6544896-6543946
MMRRC Submission 041781-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.270) question?
Stock #R4547 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location14171738-14186838 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 14175854 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 76 (I76N)
Ref Sequence ENSEMBL: ENSMUSP00000149641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035250] [ENSMUST00000206298] [ENSMUST00000216079] [ENSMUST00000217642]
Predicted Effect probably damaging
Transcript: ENSMUST00000035250
AA Change: I76N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000046509
Gene: ENSMUSG00000052417
AA Change: I76N

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 8.4e-49 PFAM
Pfam:7tm_1 40 289 8.9e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000206298
AA Change: I76N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000216079
AA Change: I76N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000217642
AA Change: I76N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.3171 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 G T 14: 54,645,667 A909E probably benign Het
Ankrd13a A G 5: 114,775,296 E23G probably benign Het
Ano4 T C 10: 88,981,170 R148G probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Aspm T C 1: 139,478,187 V1604A possibly damaging Het
Cdh1 C A 8: 106,663,903 T625K probably damaging Het
Cfap65 G A 1: 74,907,612 T1313I probably damaging Het
Cfhr3 T G 1: 139,584,913 noncoding transcript Het
Csmd1 T C 8: 16,391,797 D351G possibly damaging Het
Dis3l2 A T 1: 87,049,671 T861S probably benign Het
Dnah6 A T 6: 73,192,405 D404E probably benign Het
Dpm1 A G 2: 168,223,153 L88P probably damaging Het
Fabp3 C T 4: 130,312,452 probably null Het
Fat4 T C 3: 38,951,283 F1944L probably damaging Het
Frmd4a C A 2: 4,473,145 L46I probably damaging Het
Gpr39 G A 1: 125,677,991 V219I probably benign Het
Hace1 T A 10: 45,672,555 probably null Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Klb T A 5: 65,379,928 V867E probably benign Het
Lnpk C G 2: 74,522,286 E351Q probably benign Het
Mettl25 T C 10: 105,826,017 D364G probably damaging Het
Mrc2 G A 11: 105,336,641 V567I probably benign Het
Mrm2 T C 5: 140,328,496 T195A probably benign Het
Naaa C T 5: 92,263,586 probably null Het
Ncdn A G 4: 126,746,674 F542S probably damaging Het
Nlrp4e A G 7: 23,336,866 N715D probably benign Het
Nupl2 T C 5: 24,177,970 probably benign Het
Olfr1122 G A 2: 87,388,160 V152I probably benign Het
Psg25 A G 7: 18,524,704 L349P probably damaging Het
Rnf213 G T 11: 119,479,670 probably null Het
Scara5 A C 14: 65,670,574 K4N possibly damaging Het
Slc35f5 T C 1: 125,572,382 L211S probably benign Het
Slc44a4 T A 17: 34,927,755 F285I probably damaging Het
Slc8a3 A G 12: 81,314,851 V398A possibly damaging Het
Smc2 T C 4: 52,467,866 S737P probably benign Het
Speer2 T C 16: 69,858,849 K30E probably damaging Het
Synj1 T C 16: 90,988,282 I229V possibly damaging Het
Tac1 A G 6: 7,557,216 D74G probably damaging Het
Tbc1d17 A G 7: 44,841,347 V607A probably benign Het
Tmem132a A G 19: 10,860,200 V582A possibly damaging Het
Traf4 A G 11: 78,161,037 I207T possibly damaging Het
Trio T C 15: 27,818,982 R449G possibly damaging Het
Ubn1 G A 16: 5,072,092 R407H probably damaging Het
Vmn1r19 C T 6: 57,404,789 T109I possibly damaging Het
Vmn2r60 A G 7: 42,135,663 T100A probably null Het
Vsig8 A T 1: 172,560,596 M44L probably benign Het
Zbed5 T A 5: 129,902,851 L547* probably null Het
Other mutations in Olfr720
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02658:Olfr720 APN 14 14175732 missense possibly damaging 0.92
IGL02704:Olfr720 APN 14 14175483 missense probably benign 0.00
IGL03308:Olfr720 APN 14 14175161 missense probably benign
IGL03331:Olfr720 APN 14 14176017 missense probably benign 0.16
R0008:Olfr720 UTSW 14 14176092 start gained probably benign
R0131:Olfr720 UTSW 14 14175620 missense probably benign 0.03
R0647:Olfr720 UTSW 14 14175858 missense probably benign 0.35
R0747:Olfr720 UTSW 14 14175429 missense probably benign 0.01
R1210:Olfr720 UTSW 14 14176029 missense probably benign 0.00
R1225:Olfr720 UTSW 14 14175600 missense possibly damaging 0.89
R1525:Olfr720 UTSW 14 14175725 missense probably damaging 1.00
R1975:Olfr720 UTSW 14 14175446 missense probably damaging 1.00
R1994:Olfr720 UTSW 14 14175854 missense probably benign 0.16
R2310:Olfr720 UTSW 14 14175836 missense probably benign 0.03
R3151:Olfr720 UTSW 14 14175203 missense probably damaging 1.00
R4824:Olfr720 UTSW 14 14175885 missense probably damaging 1.00
R5063:Olfr720 UTSW 14 14175593 missense probably damaging 1.00
R5098:Olfr720 UTSW 14 14175683 missense probably benign 0.03
R5430:Olfr720 UTSW 14 14175692 missense probably benign 0.03
R5512:Olfr720 UTSW 14 14175633 missense probably damaging 1.00
R5748:Olfr720 UTSW 14 14175314 missense probably damaging 1.00
R7200:Olfr720 UTSW 14 14175477 missense probably damaging 1.00
R7407:Olfr720 UTSW 14 14175402 missense probably benign
R7666:Olfr720 UTSW 14 14176075 missense probably benign
R7760:Olfr720 UTSW 14 14175905 missense probably damaging 1.00
R8118:Olfr720 UTSW 14 14175863 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGACTCATGAGGACAGGATAAC -3'
(R):5'- TGGAAACAAAACCTTTCCCAGTG -3'

Sequencing Primer
(F):5'- CGGAGCGGATTACAGATGGC -3'
(R):5'- GTGGGACTCTTTACTCACAACAAAG -3'
Posted On2015-08-18