Incidental Mutation 'R4547:Scara5'
ID333839
Institutional Source Beutler Lab
Gene Symbol Scara5
Ensembl Gene ENSMUSG00000022032
Gene Namescavenger receptor class A, member 5
Synonyms4932433F15Rik, 4933425F03Rik
MMRRC Submission 041781-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R4547 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location65666403-65764826 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 65670574 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 4 (K4N)
Ref Sequence ENSEMBL: ENSMUSP00000063391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022610] [ENSMUST00000069226]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022610
AA Change: K4N

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000022610
Gene: ENSMUSG00000022032
AA Change: K4N

DomainStartEndE-ValueType
transmembrane domain 60 82 N/A INTRINSIC
Pfam:Collagen 304 357 1.8e-8 PFAM
Pfam:Collagen 327 383 1.1e-8 PFAM
SR 389 489 5.5e-56 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000069226
AA Change: K4N

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000063391
Gene: ENSMUSG00000022032
AA Change: K4N

DomainStartEndE-ValueType
transmembrane domain 60 82 N/A INTRINSIC
Pfam:Collagen 304 360 1e-11 PFAM
Pfam:Collagen 329 386 1.9e-11 PFAM
Meta Mutation Damage Score 0.0704 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 96% (55/57)
MGI Phenotype PHENOTYPE: Homozygous deletion of this gene results in decreased male fertility and lymphocytic infiltration of the stroma of various tissues, particularly in the lungs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 G T 14: 54,645,667 A909E probably benign Het
Ankrd13a A G 5: 114,775,296 E23G probably benign Het
Ano4 T C 10: 88,981,170 R148G probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Aspm T C 1: 139,478,187 V1604A possibly damaging Het
Cdh1 C A 8: 106,663,903 T625K probably damaging Het
Cfap65 G A 1: 74,907,612 T1313I probably damaging Het
Cfhr3 T G 1: 139,584,913 noncoding transcript Het
Csmd1 T C 8: 16,391,797 D351G possibly damaging Het
Dis3l2 A T 1: 87,049,671 T861S probably benign Het
Dnah6 A T 6: 73,192,405 D404E probably benign Het
Dpm1 A G 2: 168,223,153 L88P probably damaging Het
Fabp3 C T 4: 130,312,452 probably null Het
Fat4 T C 3: 38,951,283 F1944L probably damaging Het
Frmd4a C A 2: 4,473,145 L46I probably damaging Het
Gpr39 G A 1: 125,677,991 V219I probably benign Het
Hace1 T A 10: 45,672,555 probably null Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Klb T A 5: 65,379,928 V867E probably benign Het
Lnpk C G 2: 74,522,286 E351Q probably benign Het
Mettl25 T C 10: 105,826,017 D364G probably damaging Het
Mrc2 G A 11: 105,336,641 V567I probably benign Het
Mrm2 T C 5: 140,328,496 T195A probably benign Het
Naaa C T 5: 92,263,586 probably null Het
Ncdn A G 4: 126,746,674 F542S probably damaging Het
Nlrp4e A G 7: 23,336,866 N715D probably benign Het
Nupl2 T C 5: 24,177,970 probably benign Het
Olfr1122 G A 2: 87,388,160 V152I probably benign Het
Olfr720 A T 14: 14,175,854 I76N probably damaging Het
Psg25 A G 7: 18,524,704 L349P probably damaging Het
Rnf213 G T 11: 119,479,670 probably null Het
Slc35f5 T C 1: 125,572,382 L211S probably benign Het
Slc44a4 T A 17: 34,927,755 F285I probably damaging Het
Slc8a3 A G 12: 81,314,851 V398A possibly damaging Het
Smc2 T C 4: 52,467,866 S737P probably benign Het
Speer2 T C 16: 69,858,849 K30E probably damaging Het
Synj1 T C 16: 90,988,282 I229V possibly damaging Het
Tac1 A G 6: 7,557,216 D74G probably damaging Het
Tbc1d17 A G 7: 44,841,347 V607A probably benign Het
Tmem132a A G 19: 10,860,200 V582A possibly damaging Het
Traf4 A G 11: 78,161,037 I207T possibly damaging Het
Trio T C 15: 27,818,982 R449G possibly damaging Het
Ubn1 G A 16: 5,072,092 R407H probably damaging Het
Vmn1r19 C T 6: 57,404,789 T109I possibly damaging Het
Vmn2r60 A G 7: 42,135,663 T100A probably null Het
Vsig8 A T 1: 172,560,596 M44L probably benign Het
Zbed5 T A 5: 129,902,851 L547* probably null Het
Other mutations in Scara5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Scara5 APN 14 65738415 splice site probably benign
IGL00772:Scara5 APN 14 65670562 utr 5 prime probably benign
IGL01768:Scara5 APN 14 65689775 nonsense probably null
IGL02081:Scara5 APN 14 65730655 missense possibly damaging 0.96
IGL02280:Scara5 APN 14 65730778 missense probably benign
IGL02795:Scara5 APN 14 65730680 missense possibly damaging 0.72
IGL02887:Scara5 APN 14 65762829 missense unknown
R0040:Scara5 UTSW 14 65762717 splice site probably benign
R0605:Scara5 UTSW 14 65759648 missense possibly damaging 0.85
R0735:Scara5 UTSW 14 65731019 missense possibly damaging 0.85
R0925:Scara5 UTSW 14 65762718 critical splice acceptor site probably benign
R1575:Scara5 UTSW 14 65730865 missense probably benign 0.18
R1746:Scara5 UTSW 14 65731090 missense probably benign
R1968:Scara5 UTSW 14 65689800 missense possibly damaging 0.73
R4455:Scara5 UTSW 14 65762747 missense probably benign 0.01
R4779:Scara5 UTSW 14 65730749 missense probably benign 0.03
R5218:Scara5 UTSW 14 65759662 frame shift probably null
R5316:Scara5 UTSW 14 65689815 missense possibly damaging 0.73
R5331:Scara5 UTSW 14 65759662 frame shift probably null
R5332:Scara5 UTSW 14 65759662 frame shift probably null
R5366:Scara5 UTSW 14 65759662 frame shift probably null
R5367:Scara5 UTSW 14 65759662 frame shift probably null
R5368:Scara5 UTSW 14 65759662 frame shift probably null
R5369:Scara5 UTSW 14 65759662 frame shift probably null
R5417:Scara5 UTSW 14 65759662 frame shift probably null
R5418:Scara5 UTSW 14 65759662 frame shift probably null
R5420:Scara5 UTSW 14 65759662 frame shift probably null
R5447:Scara5 UTSW 14 65759662 frame shift probably null
R5473:Scara5 UTSW 14 65740339 missense possibly damaging 0.84
R5580:Scara5 UTSW 14 65731079 missense probably benign 0.02
R7734:Scara5 UTSW 14 65731151 missense possibly damaging 0.85
R7995:Scara5 UTSW 14 65759608 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- AACCCATGTCAATGCATCTGTG -3'
(R):5'- GGGTATCCAAAGCACAGTGG -3'

Sequencing Primer
(F):5'- CGGTCACTGAGGCTTACACAG -3'
(R):5'- GTGGAAATTAAGGATCTTCAACACCC -3'
Posted On2015-08-18