Mutagenetix > Incidental Mutation

Incidental Mutation 'R4548:Cfap65'

333847

Institutional Source

Beutler Lab

Gene Symbol

Cfap65

Ensembl Gene

ENSMUSG00000047021

Gene Name

cilia and flagella associated protein 65

Synonyms

Ccdc108, B230363K08Rik

MMRRC Submission

041594-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.677) question?

Stock #

R4548 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

74941230-74974758 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 74946771 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 1313 (T1313I)

Ref Sequence

ENSEMBL: ENSMUSP00000092440 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094844]

AlphaFold

Q3V0B4

Predicted Effect

probably damaging
Transcript: ENSMUST00000094844
AA Change: T1313I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: T1313I

Domain	Start	End	E-Value	Type
transmembrane domain	111	133	N/A	INTRINSIC
low complexity region	212	223	N/A	INTRINSIC
internal_repeat_1	745	890	9.31e-5	PROSPERO
internal_repeat_1	1167	1322	9.31e-5	PROSPERO
low complexity region	1350	1361	N/A	INTRINSIC
low complexity region	1574	1592	N/A	INTRINSIC
coiled coil region	1687	1724	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160540

Meta Mutation Damage Score

0.2470

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca17	A	T	17: 24,553,245 (GRCm39)	F155L	possibly damaging	Het
Adcy6	A	G	15: 98,496,540 (GRCm39)	I545T	probably damaging	Het
Afg2a	T	A	3: 37,486,176 (GRCm39)	N299K	probably benign	Het
Akip1	C	A	7: 109,304,193 (GRCm39)	S90*	probably null	Het
Anln	T	C	9: 22,274,184 (GRCm39)	D551G	possibly damaging	Het
Arhgef17	T	C	7: 100,580,336 (GRCm39)	Q204R	possibly damaging	Het
Arl6ip1	AAAATAAATAAATAAATAAATAAATA	AAAATAAATAAATAAATAAATAAATAAATA	7: 117,721,122 (GRCm39)		probably benign	Het
Bcl2l11	A	G	2: 127,971,566 (GRCm39)	E75G	probably benign	Het
Cfap45	A	G	1: 172,372,675 (GRCm39)	I457V	probably benign	Het
Cntln	C	A	4: 85,015,079 (GRCm39)	H1123Q	probably benign	Het
Cops3	C	T	11: 59,718,671 (GRCm39)		probably null	Het
Dis3l2	A	T	1: 86,977,393 (GRCm39)	T861S	probably benign	Het
Dnajc11	A	G	4: 152,058,074 (GRCm39)	N281S	possibly damaging	Het
Fabp3	C	T	4: 130,206,245 (GRCm39)		probably null	Het
Fras1	A	G	5: 96,857,754 (GRCm39)	D2016G	probably benign	Het
Gpr39	G	A	1: 125,605,728 (GRCm39)	V219I	probably benign	Het
Greb1	T	C	12: 16,749,676 (GRCm39)	D1050G	probably damaging	Het
Kcnh6	T	C	11: 105,899,875 (GRCm39)	F48S	probably damaging	Het
Kdm1b	C	T	13: 47,216,553 (GRCm39)	R308W	probably damaging	Het
Mrm2	T	C	5: 140,314,251 (GRCm39)	T195A	probably benign	Het
Myzap	T	C	9: 71,457,528 (GRCm39)	E289G	possibly damaging	Het
Nemp1	A	G	10: 127,532,213 (GRCm39)	E373G	probably benign	Het
Or13c7	T	A	4: 43,854,834 (GRCm39)	I175N	probably damaging	Het
Or8h10	T	C	2: 86,809,014 (GRCm39)	N42S	probably damaging	Het
Polr1c	A	T	17: 46,558,735 (GRCm39)		probably null	Het
Rev1	A	G	1: 38,098,275 (GRCm39)	M756T	possibly damaging	Het
Sacs	A	G	14: 61,429,387 (GRCm39)	D482G	probably damaging	Het
Sfrp4	A	G	13: 19,807,936 (GRCm39)	M112V	possibly damaging	Het
Slc7a4	T	C	16: 17,393,209 (GRCm39)	T197A	probably benign	Het
Snx27	C	T	3: 94,433,746 (GRCm39)		probably benign	Het
Speer2	T	C	16: 69,655,737 (GRCm39)	K30E	probably damaging	Het
Ssh2	G	A	11: 77,341,010 (GRCm39)	A721T	probably benign	Het
Trappc3	A	G	4: 126,166,544 (GRCm39)	D39G	possibly damaging	Het
Ttc28	G	A	5: 111,419,090 (GRCm39)	S1362N	possibly damaging	Het
Ugt2b35	A	T	5: 87,156,134 (GRCm39)	K409*	probably null	Het
Vmn2r92	A	T	17: 18,391,578 (GRCm39)	M527L	probably benign	Het
Zbed5	T	A	5: 129,931,692 (GRCm39)	L547*	probably null	Het

Other mutations in Cfap65

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01107:Cfap65	APN	1	74,958,342 (GRCm39)	critical splice donor site	probably null
IGL01526:Cfap65	APN	1	74,950,237 (GRCm39)	missense	probably damaging	1.00
IGL01716:Cfap65	APN	1	74,966,353 (GRCm39)	missense	probably benign
IGL01780:Cfap65	APN	1	74,967,507 (GRCm39)	nonsense	probably null
IGL01993:Cfap65	APN	1	74,959,702 (GRCm39)	missense	probably damaging	1.00
IGL02164:Cfap65	APN	1	74,967,304 (GRCm39)	missense	possibly damaging	0.87
IGL02350:Cfap65	APN	1	74,967,507 (GRCm39)	nonsense	probably null
IGL02357:Cfap65	APN	1	74,967,507 (GRCm39)	nonsense	probably null
IGL02576:Cfap65	APN	1	74,942,617 (GRCm39)	missense	probably damaging	1.00
IGL02756:Cfap65	APN	1	74,944,239 (GRCm39)	missense	probably benign	0.00
IGL02792:Cfap65	APN	1	74,966,337 (GRCm39)	missense	probably damaging	1.00
IGL02874:Cfap65	APN	1	74,950,267 (GRCm39)	nonsense	probably null
IGL03101:Cfap65	APN	1	74,967,592 (GRCm39)	missense	possibly damaging	0.61
IGL03348:Cfap65	APN	1	74,966,778 (GRCm39)	missense	probably damaging	1.00
IGL03396:Cfap65	APN	1	74,943,801 (GRCm39)	missense	probably damaging	1.00
PIT4131001:Cfap65	UTSW	1	74,967,501 (GRCm39)	missense	probably benign	0.05
R0077:Cfap65	UTSW	1	74,971,077 (GRCm39)	missense	probably damaging	1.00
R0227:Cfap65	UTSW	1	74,971,117 (GRCm39)	nonsense	probably null
R0281:Cfap65	UTSW	1	74,966,230 (GRCm39)	missense	probably damaging	1.00
R0312:Cfap65	UTSW	1	74,943,226 (GRCm39)	missense	probably damaging	1.00
R0331:Cfap65	UTSW	1	74,968,461 (GRCm39)	missense	probably damaging	1.00
R0331:Cfap65	UTSW	1	74,968,460 (GRCm39)	missense	probably damaging	1.00
R0347:Cfap65	UTSW	1	74,965,603 (GRCm39)	missense	probably damaging	1.00
R0359:Cfap65	UTSW	1	74,959,760 (GRCm39)	missense	probably benign	0.00
R0361:Cfap65	UTSW	1	74,964,599 (GRCm39)	missense	probably damaging	1.00
R0465:Cfap65	UTSW	1	74,956,043 (GRCm39)	missense	possibly damaging	0.92
R0549:Cfap65	UTSW	1	74,957,603 (GRCm39)	missense	probably benign	0.01
R0646:Cfap65	UTSW	1	74,941,328 (GRCm39)	missense	probably benign	0.09
R0734:Cfap65	UTSW	1	74,958,046 (GRCm39)	missense	probably damaging	1.00
R0763:Cfap65	UTSW	1	74,943,841 (GRCm39)	missense	probably damaging	0.99
R0990:Cfap65	UTSW	1	74,960,678 (GRCm39)	missense	possibly damaging	0.60
R1079:Cfap65	UTSW	1	74,944,872 (GRCm39)	missense	probably damaging	0.99
R1079:Cfap65	UTSW	1	74,941,606 (GRCm39)	missense	probably damaging	0.98
R1083:Cfap65	UTSW	1	74,957,663 (GRCm39)	splice site	probably benign
R1159:Cfap65	UTSW	1	74,968,499 (GRCm39)	missense	probably damaging	1.00
R1282:Cfap65	UTSW	1	74,964,263 (GRCm39)	missense	probably benign	0.03
R1644:Cfap65	UTSW	1	74,956,334 (GRCm39)	missense	probably damaging	1.00
R1796:Cfap65	UTSW	1	74,958,107 (GRCm39)	missense	probably damaging	1.00
R1950:Cfap65	UTSW	1	74,946,819 (GRCm39)	missense	probably damaging	1.00
R2079:Cfap65	UTSW	1	74,956,358 (GRCm39)	missense	probably benign	0.30
R2132:Cfap65	UTSW	1	74,946,850 (GRCm39)	missense	probably damaging	1.00
R2136:Cfap65	UTSW	1	74,956,432 (GRCm39)	frame shift	probably null
R2219:Cfap65	UTSW	1	74,943,184 (GRCm39)	missense	probably damaging	1.00
R2220:Cfap65	UTSW	1	74,943,184 (GRCm39)	missense	probably damaging	1.00
R2291:Cfap65	UTSW	1	74,965,634 (GRCm39)	missense	probably damaging	1.00
R2417:Cfap65	UTSW	1	74,966,345 (GRCm39)	small insertion	probably benign
R3114:Cfap65	UTSW	1	74,966,291 (GRCm39)	missense	probably damaging	1.00
R4202:Cfap65	UTSW	1	74,959,701 (GRCm39)	missense	probably damaging	1.00
R4214:Cfap65	UTSW	1	74,966,840 (GRCm39)	missense	possibly damaging	0.93
R4254:Cfap65	UTSW	1	74,942,517 (GRCm39)	missense	probably benign	0.17
R4547:Cfap65	UTSW	1	74,946,771 (GRCm39)	missense	probably damaging	1.00
R4588:Cfap65	UTSW	1	74,943,215 (GRCm39)	missense	possibly damaging	0.92
R4657:Cfap65	UTSW	1	74,964,513 (GRCm39)	intron	probably benign
R4701:Cfap65	UTSW	1	74,958,067 (GRCm39)	missense	probably damaging	0.96
R4755:Cfap65	UTSW	1	74,967,520 (GRCm39)	missense	probably damaging	1.00
R4820:Cfap65	UTSW	1	74,966,791 (GRCm39)	missense	probably benign	0.06
R4831:Cfap65	UTSW	1	74,956,454 (GRCm39)	missense	possibly damaging	0.93
R4866:Cfap65	UTSW	1	74,964,716 (GRCm39)	missense	probably damaging	1.00
R4869:Cfap65	UTSW	1	74,958,420 (GRCm39)	missense	probably benign	0.00
R4881:Cfap65	UTSW	1	74,946,772 (GRCm39)	missense	probably damaging	1.00
R4884:Cfap65	UTSW	1	74,942,283 (GRCm39)	missense	possibly damaging	0.47
R4950:Cfap65	UTSW	1	74,945,495 (GRCm39)	nonsense	probably null
R5074:Cfap65	UTSW	1	74,962,137 (GRCm39)	missense	probably benign	0.04
R5083:Cfap65	UTSW	1	74,945,600 (GRCm39)	missense	probably damaging	1.00
R5164:Cfap65	UTSW	1	74,965,675 (GRCm39)	missense	probably damaging	1.00
R5268:Cfap65	UTSW	1	74,964,061 (GRCm39)	missense	probably benign	0.07
R5333:Cfap65	UTSW	1	74,942,334 (GRCm39)	missense	probably benign	0.03
R5417:Cfap65	UTSW	1	74,964,259 (GRCm39)	missense	probably damaging	1.00
R5582:Cfap65	UTSW	1	74,946,677 (GRCm39)	intron	probably benign
R5669:Cfap65	UTSW	1	74,964,127 (GRCm39)	missense	probably damaging	0.99
R6010:Cfap65	UTSW	1	74,962,190 (GRCm39)	missense	probably damaging	1.00
R6084:Cfap65	UTSW	1	74,959,564 (GRCm39)	missense	probably damaging	1.00
R6112:Cfap65	UTSW	1	74,942,298 (GRCm39)	missense	probably benign	0.14
R6425:Cfap65	UTSW	1	74,966,868 (GRCm39)	missense	probably benign	0.00
R6677:Cfap65	UTSW	1	74,943,844 (GRCm39)	missense	probably damaging	1.00
R6693:Cfap65	UTSW	1	74,956,445 (GRCm39)	missense	probably benign	0.00
R6838:Cfap65	UTSW	1	74,971,180 (GRCm39)	missense	probably benign	0.06
R6861:Cfap65	UTSW	1	74,964,274 (GRCm39)	missense	probably damaging	1.00
R6958:Cfap65	UTSW	1	74,971,058 (GRCm39)	missense	possibly damaging	0.58
R7134:Cfap65	UTSW	1	74,965,792 (GRCm39)	missense	probably benign	0.01
R7320:Cfap65	UTSW	1	74,965,763 (GRCm39)	missense	probably damaging	0.99
R7340:Cfap65	UTSW	1	74,960,742 (GRCm39)	missense	probably benign	0.07
R7426:Cfap65	UTSW	1	74,959,585 (GRCm39)	missense	possibly damaging	0.92
R7529:Cfap65	UTSW	1	74,965,769 (GRCm39)	missense	probably damaging	1.00
R7634:Cfap65	UTSW	1	74,941,593 (GRCm39)	missense	probably damaging	1.00
R7654:Cfap65	UTSW	1	74,972,303 (GRCm39)	missense	probably benign	0.44
R7704:Cfap65	UTSW	1	74,967,527 (GRCm39)	missense	probably benign	0.19
R7727:Cfap65	UTSW	1	74,965,784 (GRCm39)	missense	probably benign	0.00
R7895:Cfap65	UTSW	1	74,972,321 (GRCm39)	missense	probably benign	0.05
R8215:Cfap65	UTSW	1	74,949,902 (GRCm39)	missense	probably damaging	1.00
R8344:Cfap65	UTSW	1	74,967,203 (GRCm39)	missense	probably benign	0.01
R8345:Cfap65	UTSW	1	74,967,203 (GRCm39)	missense	probably benign	0.01
R8413:Cfap65	UTSW	1	74,956,328 (GRCm39)	nonsense	probably null
R8431:Cfap65	UTSW	1	74,967,203 (GRCm39)	missense	probably benign	0.01
R8432:Cfap65	UTSW	1	74,967,203 (GRCm39)	missense	probably benign	0.01
R8528:Cfap65	UTSW	1	74,945,096 (GRCm39)	missense	possibly damaging	0.88
R8809:Cfap65	UTSW	1	74,942,382 (GRCm39)	missense	probably benign	0.43
R8996:Cfap65	UTSW	1	74,941,347 (GRCm39)	missense	probably benign	0.11
R9020:Cfap65	UTSW	1	74,959,552 (GRCm39)	missense	probably damaging	1.00
R9043:Cfap65	UTSW	1	74,943,847 (GRCm39)	missense	possibly damaging	0.88
R9127:Cfap65	UTSW	1	74,958,510 (GRCm39)	splice site	probably benign
R9187:Cfap65	UTSW	1	74,956,517 (GRCm39)	missense	probably benign	0.00
R9210:Cfap65	UTSW	1	74,959,567 (GRCm39)	missense	probably benign
R9212:Cfap65	UTSW	1	74,959,567 (GRCm39)	missense	probably benign
R9273:Cfap65	UTSW	1	74,960,769 (GRCm39)	missense	probably benign	0.00
R9454:Cfap65	UTSW	1	74,944,210 (GRCm39)	missense	probably damaging	1.00
R9514:Cfap65	UTSW	1	74,945,468 (GRCm39)	critical splice donor site	probably null
R9595:Cfap65	UTSW	1	74,946,537 (GRCm39)	missense	probably damaging	1.00
R9721:Cfap65	UTSW	1	74,958,501 (GRCm39)	missense	probably benign	0.16
R9742:Cfap65	UTSW	1	74,943,840 (GRCm39)	missense	probably benign	0.08
RF009:Cfap65	UTSW	1	74,944,806 (GRCm39)	missense	probably damaging	1.00
Z1176:Cfap65	UTSW	1	74,949,906 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGACACAGGGGTCATATCCTAC -3'
(R):5'- CTACCCTTGCAGATTTACGAGC -3'

Sequencing Primer
(F):5'- GGTCATATCCTACTCCTTGGAAGCAG -3'
(R):5'- CAGATTTACGAGCTGTACAATGGC -3'

Posted On

2015-08-18