Incidental Mutation 'R4548:Dis3l2'
ID333848
Institutional Source Beutler Lab
Gene Symbol Dis3l2
Ensembl Gene ENSMUSG00000053333
Gene NameDIS3 like 3'-5' exoribonuclease 2
Synonyms4930429A22Rik, 8030493P09Rik
MMRRC Submission 041594-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.274) question?
Stock #R4548 (G1)
Quality Score189
Status Not validated
Chromosome1
Chromosomal Location86703808-87050095 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87049671 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 861 (T861S)
Ref Sequence ENSEMBL: ENSMUSP00000132673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065694] [ENSMUST00000168237] [ENSMUST00000190618]
Predicted Effect probably benign
Transcript: ENSMUST00000065694
AA Change: T847S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000070506
Gene: ENSMUSG00000053333
AA Change: T847S

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
RNB 369 719 8.9e-140 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168237
AA Change: T861S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000132673
Gene: ENSMUSG00000053333
AA Change: T861S

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
RNB 383 733 8.9e-140 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185304
Predicted Effect probably benign
Transcript: ENSMUST00000190618
SMART Domains Protein: ENSMUSP00000139579
Gene: ENSMUSG00000053333

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
PDB:2VNU|D 50 123 4e-10 PDB
Meta Mutation Damage Score 0.0628 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar in sequence to 3'/5' exonucleolytic subunits of the RNA exosome. The exosome is a large multimeric ribonucleotide complex responsible for degrading various RNA substrates. Several transcript variants, some protein-coding and some not, have been found for this gene. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,334,271 F155L possibly damaging Het
Adcy6 A G 15: 98,598,659 I545T probably damaging Het
Akip1 C A 7: 109,704,986 S90* probably null Het
Anln T C 9: 22,362,888 D551G possibly damaging Het
Arhgef17 T C 7: 100,931,129 Q204R possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Bcl2l11 A G 2: 128,129,646 E75G probably benign Het
Cfap45 A G 1: 172,545,108 I457V probably benign Het
Cfap65 G A 1: 74,907,612 T1313I probably damaging Het
Cntln C A 4: 85,096,842 H1123Q probably benign Het
Cops3 C T 11: 59,827,845 probably null Het
Dnajc11 A G 4: 151,973,617 N281S possibly damaging Het
Fabp3 C T 4: 130,312,452 probably null Het
Fras1 A G 5: 96,709,895 D2016G probably benign Het
Gpr39 G A 1: 125,677,991 V219I probably benign Het
Greb1 T C 12: 16,699,675 D1050G probably damaging Het
Kcnh6 T C 11: 106,009,049 F48S probably damaging Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Mrm2 T C 5: 140,328,496 T195A probably benign Het
Myzap T C 9: 71,550,246 E289G possibly damaging Het
Nemp1 A G 10: 127,696,344 E373G probably benign Het
Olfr1100 T C 2: 86,978,670 N42S probably damaging Het
Olfr155 T A 4: 43,854,834 I175N probably damaging Het
Polr1c A T 17: 46,247,809 probably null Het
Rev1 A G 1: 38,059,194 M756T possibly damaging Het
Sacs A G 14: 61,191,938 D482G probably damaging Het
Sfrp4 A G 13: 19,623,766 M112V possibly damaging Het
Slc7a4 T C 16: 17,575,345 T197A probably benign Het
Snx27 C T 3: 94,526,439 probably benign Het
Spata5 T A 3: 37,432,027 N299K probably benign Het
Speer2 T C 16: 69,858,849 K30E probably damaging Het
Ssh2 G A 11: 77,450,184 A721T probably benign Het
Trappc3 A G 4: 126,272,751 D39G possibly damaging Het
Ttc28 G A 5: 111,271,224 S1362N possibly damaging Het
Ugt2b35 A T 5: 87,008,275 K409* probably null Het
Vmn2r92 A T 17: 18,171,316 M527L probably benign Het
Zbed5 T A 5: 129,902,851 L547* probably null Het
Other mutations in Dis3l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Dis3l2 APN 1 86857203 missense probably benign 0.00
IGL01607:Dis3l2 APN 1 86745487 missense probably benign 0.04
IGL02233:Dis3l2 APN 1 86990231 missense probably damaging 1.00
IGL02698:Dis3l2 APN 1 87048829 splice site probably benign
R0514:Dis3l2 UTSW 1 87047092 missense probably damaging 1.00
R0893:Dis3l2 UTSW 1 87044206 splice site probably null
R1086:Dis3l2 UTSW 1 86990149 missense probably benign 0.36
R1140:Dis3l2 UTSW 1 86821438 missense probably benign 0.00
R1509:Dis3l2 UTSW 1 87021086 missense possibly damaging 0.91
R2029:Dis3l2 UTSW 1 86854467 splice site probably benign
R2511:Dis3l2 UTSW 1 86990258 missense probably benign 0.05
R3772:Dis3l2 UTSW 1 86854408 missense probably benign
R4163:Dis3l2 UTSW 1 86821237 missense probably benign 0.00
R4547:Dis3l2 UTSW 1 87049671 missense probably benign 0.00
R4650:Dis3l2 UTSW 1 86990321 missense possibly damaging 0.83
R4810:Dis3l2 UTSW 1 87047574 missense probably damaging 0.99
R4936:Dis3l2 UTSW 1 87044168 missense probably benign 0.00
R5010:Dis3l2 UTSW 1 86760321 missense probably benign 0.21
R5040:Dis3l2 UTSW 1 86857337 missense probably damaging 0.98
R5272:Dis3l2 UTSW 1 86973404 missense possibly damaging 0.72
R5500:Dis3l2 UTSW 1 87021119 critical splice donor site probably null
R5556:Dis3l2 UTSW 1 86973404 missense possibly damaging 0.72
R5772:Dis3l2 UTSW 1 86878432 missense probably damaging 1.00
R5808:Dis3l2 UTSW 1 87049638 missense possibly damaging 0.94
R5950:Dis3l2 UTSW 1 87021108 missense probably damaging 0.96
R6328:Dis3l2 UTSW 1 86854431 missense probably benign 0.05
R6553:Dis3l2 UTSW 1 86745494 missense probably damaging 1.00
R6585:Dis3l2 UTSW 1 86745494 missense probably damaging 1.00
R6905:Dis3l2 UTSW 1 87044839 missense probably benign 0.00
R6921:Dis3l2 UTSW 1 86857341 missense probably benign
R7162:Dis3l2 UTSW 1 87044030 missense possibly damaging 0.94
R7270:Dis3l2 UTSW 1 86990303 missense possibly damaging 0.49
R7438:Dis3l2 UTSW 1 86745500 critical splice donor site probably null
X0027:Dis3l2 UTSW 1 86760351 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CCCAATGAATCCCATTTACAGATAG -3'
(R):5'- ATCCTCTCTGCTCAGGGAAG -3'

Sequencing Primer
(F):5'- TCCCATTTACAGATAGGCGATAGAG -3'
(R):5'- TCTCTGCTCAGGGAAGCACAG -3'
Posted On2015-08-18