Incidental Mutation 'R4548:Spata5'
ID 333854
Institutional Source Beutler Lab
Gene Symbol Spata5
Ensembl Gene ENSMUSG00000027722
Gene Name spermatogenesis associated 5
Synonyms C78064, 2510048F20Rik, Spaf
MMRRC Submission 041594-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4548 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 37419896-37579096 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 37432027 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 299 (N299K)
Ref Sequence ENSEMBL: ENSMUSP00000143349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029277] [ENSMUST00000108112] [ENSMUST00000198968]
AlphaFold Q3UMC0
Predicted Effect probably benign
Transcript: ENSMUST00000029277
AA Change: N298K

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000029277
Gene: ENSMUSG00000027722
AA Change: N298K

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
CDC48_N 44 135 2.47e-1 SMART
low complexity region 276 287 N/A INTRINSIC
AAA 385 524 4.96e-21 SMART
Blast:AAA 553 622 9e-21 BLAST
AAA 659 797 2.48e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108112
AA Change: N299K

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000103747
Gene: ENSMUSG00000027722
AA Change: N299K

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
CDC48_N 44 136 1.14e0 SMART
low complexity region 277 288 N/A INTRINSIC
AAA 386 525 4.96e-21 SMART
Blast:AAA 554 623 9e-21 BLAST
AAA 660 798 2.48e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124347
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142199
Predicted Effect probably benign
Transcript: ENSMUST00000198968
AA Change: N299K

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000143349
Gene: ENSMUSG00000027722
AA Change: N299K

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
CDC48_N 44 136 8.6e-5 SMART
low complexity region 277 288 N/A INTRINSIC
AAA 386 525 8.2e-23 SMART
Blast:AAA 554 623 7e-21 BLAST
AAA 660 798 4e-23 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ATPase associated with diverse activities family, whose members are defined by a highly conserved ATPase domain. Members of this family participate in diverse cellular processes that include membrane fusion, DNA replication, microtubule severing, and protein degradation. The protein encoded by this gene has a putative mitochondrial targeting sequence and has been proposed to function in maintenance of mitochondrial function and integrity during mouse spermatogenesis. Allelic variants in this gene have been associated with epilepsy, hearing loss, and mental retardation syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,334,271 F155L possibly damaging Het
Adcy6 A G 15: 98,598,659 I545T probably damaging Het
Akip1 C A 7: 109,704,986 S90* probably null Het
Anln T C 9: 22,362,888 D551G possibly damaging Het
Arhgef17 T C 7: 100,931,129 Q204R possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Bcl2l11 A G 2: 128,129,646 E75G probably benign Het
Cfap45 A G 1: 172,545,108 I457V probably benign Het
Cfap65 G A 1: 74,907,612 T1313I probably damaging Het
Cntln C A 4: 85,096,842 H1123Q probably benign Het
Cops3 C T 11: 59,827,845 probably null Het
Dis3l2 A T 1: 87,049,671 T861S probably benign Het
Dnajc11 A G 4: 151,973,617 N281S possibly damaging Het
Fabp3 C T 4: 130,312,452 probably null Het
Fras1 A G 5: 96,709,895 D2016G probably benign Het
Gpr39 G A 1: 125,677,991 V219I probably benign Het
Greb1 T C 12: 16,699,675 D1050G probably damaging Het
Kcnh6 T C 11: 106,009,049 F48S probably damaging Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Mrm2 T C 5: 140,328,496 T195A probably benign Het
Myzap T C 9: 71,550,246 E289G possibly damaging Het
Nemp1 A G 10: 127,696,344 E373G probably benign Het
Olfr1100 T C 2: 86,978,670 N42S probably damaging Het
Olfr155 T A 4: 43,854,834 I175N probably damaging Het
Polr1c A T 17: 46,247,809 probably null Het
Rev1 A G 1: 38,059,194 M756T possibly damaging Het
Sacs A G 14: 61,191,938 D482G probably damaging Het
Sfrp4 A G 13: 19,623,766 M112V possibly damaging Het
Slc7a4 T C 16: 17,575,345 T197A probably benign Het
Snx27 C T 3: 94,526,439 probably benign Het
Speer2 T C 16: 69,858,849 K30E probably damaging Het
Ssh2 G A 11: 77,450,184 A721T probably benign Het
Trappc3 A G 4: 126,272,751 D39G possibly damaging Het
Ttc28 G A 5: 111,271,224 S1362N possibly damaging Het
Ugt2b35 A T 5: 87,008,275 K409* probably null Het
Vmn2r92 A T 17: 18,171,316 M527L probably benign Het
Zbed5 T A 5: 129,902,851 L547* probably null Het
Other mutations in Spata5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Spata5 APN 3 37451802 missense possibly damaging 0.60
IGL00472:Spata5 APN 3 37436644 missense probably benign
IGL02664:Spata5 APN 3 37436665 missense probably damaging 1.00
IGL02797:Spata5 APN 3 37458316 splice site probably benign
IGL02869:Spata5 APN 3 37464545 missense probably damaging 1.00
IGL02891:Spata5 APN 3 37426192 missense probably damaging 0.97
IGL03065:Spata5 APN 3 37432179 missense possibly damaging 0.75
IGL03121:Spata5 APN 3 37464651 missense probably damaging 1.00
IGL03178:Spata5 APN 3 37578783 missense probably damaging 1.00
R0494:Spata5 UTSW 3 37432163 missense possibly damaging 0.79
R0621:Spata5 UTSW 3 37432029 missense probably benign 0.06
R0908:Spata5 UTSW 3 37431623 splice site probably null
R1773:Spata5 UTSW 3 37439185 missense probably damaging 0.99
R2016:Spata5 UTSW 3 37578762 missense possibly damaging 0.48
R3714:Spata5 UTSW 3 37433209 missense probably benign
R3836:Spata5 UTSW 3 37433643 missense possibly damaging 0.91
R4695:Spata5 UTSW 3 37458325 missense probably damaging 1.00
R4758:Spata5 UTSW 3 37433236 missense probably benign 0.01
R5009:Spata5 UTSW 3 37433277 splice site probably benign
R5839:Spata5 UTSW 3 37464654 missense probably damaging 1.00
R6437:Spata5 UTSW 3 37528198 missense probably damaging 1.00
R7067:Spata5 UTSW 3 37431698 nonsense probably null
R7450:Spata5 UTSW 3 37456785 missense probably damaging 1.00
R7889:Spata5 UTSW 3 37578810 missense probably benign 0.01
R7898:Spata5 UTSW 3 37420471 missense probably benign 0.04
R8108:Spata5 UTSW 3 37431782 missense probably benign 0.25
R8511:Spata5 UTSW 3 37436748 missense probably damaging 0.99
R8870:Spata5 UTSW 3 37448512 missense probably benign 0.35
R8941:Spata5 UTSW 3 37431993 missense probably damaging 0.97
R9475:Spata5 UTSW 3 37431909 missense probably benign
R9605:Spata5 UTSW 3 37451781 missense probably damaging 1.00
Z1176:Spata5 UTSW 3 37431750 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- ATCTATCCTTCCAGCTAAGCCAG -3'
(R):5'- AGCTGACTGTTTAAGCCTCC -3'

Sequencing Primer
(F):5'- TCCAGCTAAGCCAGTTAGATCTG -3'
(R):5'- GACTGTTTAAGCCTCCAATCATG -3'
Posted On 2015-08-18