Incidental Mutation 'R0207:Igf2bp3'
ID33386
Institutional Source Beutler Lab
Gene Symbol Igf2bp3
Ensembl Gene ENSMUSG00000029814
Gene Nameinsulin-like growth factor 2 mRNA binding protein 3
SynonymsIMP3, 2610101N11Rik, Koc13
MMRRC Submission 038460-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0207 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location49085223-49214957 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49105617 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 344 (M344L)
Ref Sequence ENSEMBL: ENSMUSP00000031838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031838]
Predicted Effect probably benign
Transcript: ENSMUST00000031838
AA Change: M344L

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000031838
Gene: ENSMUSG00000029814
AA Change: M344L

DomainStartEndE-ValueType
RRM 3 71 1.96e-8 SMART
RRM 82 152 3.92e-8 SMART
low complexity region 164 182 N/A INTRINSIC
KH 194 265 3.01e-11 SMART
KH 275 348 1.51e-16 SMART
low complexity region 377 398 N/A INTRINSIC
KH 404 475 2.16e-12 SMART
KH 486 558 1.66e-13 SMART
low complexity region 559 570 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203863
Meta Mutation Damage Score 0.0717 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.5%
Validation Efficiency 95% (76/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is primarily found in the nucleolus, where it can bind to the 5' UTR of the insulin-like growth factor II leader 3 mRNA and may repress translation of insulin-like growth factor II during late development. The encoded protein contains several KH domains, which are important in RNA binding and are known to be involved in RNA synthesis and metabolism. A pseudogene exists on chromosome 7, and there are putative pseudogenes on other chromosomes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,086,039 F488S probably damaging Het
Acap3 C T 4: 155,899,424 R116W probably damaging Het
Adamts10 C A 17: 33,545,390 P663T possibly damaging Het
Akap12 G A 10: 4,353,333 G48S probably damaging Het
Ankrd7 T A 6: 18,870,031 M261K probably benign Het
Ankzf1 C A 1: 75,198,304 D599E possibly damaging Het
Aox1 T C 1: 58,105,014 I1278T possibly damaging Het
Apcdd1 T C 18: 62,950,079 Y327H probably benign Het
Asxl3 T A 18: 22,411,496 probably benign Het
Birc6 C A 17: 74,662,832 probably benign Het
Btaf1 T A 19: 37,009,648 L1714* probably null Het
Cacng6 T A 7: 3,425,004 probably benign Het
Cdc20b A G 13: 113,078,612 D238G probably damaging Het
Celf5 T A 10: 81,470,698 R113W probably null Het
Cfap70 C A 14: 20,412,347 E659D probably damaging Het
Clspn T A 4: 126,590,598 M1183K possibly damaging Het
Dpy19l1 G A 9: 24,453,891 R275C probably damaging Het
Dst C T 1: 34,186,935 S1721L probably benign Het
Faap100 T C 11: 120,374,365 T562A probably damaging Het
Fam168b T C 1: 34,819,688 M133V probably damaging Het
Farp2 T C 1: 93,569,087 I172T probably damaging Het
Fer T G 17: 63,896,278 S68A probably damaging Het
Fmo5 A G 3: 97,645,681 E315G probably damaging Het
Gpr89 A T 3: 96,871,480 F426I probably damaging Het
Hinfp T C 9: 44,296,327 I461V possibly damaging Het
Hsd11b1 A T 1: 193,240,248 V167D probably damaging Het
Htt A G 5: 34,896,908 K2574E probably benign Het
I830077J02Rik A G 3: 105,926,505 S112P probably benign Het
Itch A T 2: 155,202,257 Q494L probably benign Het
Itga9 T C 9: 118,769,253 probably benign Het
Jaml T A 9: 45,093,767 D152E probably benign Het
Kif22 A C 7: 127,042,400 M1R probably null Het
Kifap3 T C 1: 163,883,386 Y663H probably benign Het
Letm2 T A 8: 25,578,770 N472I probably damaging Het
Mthfr T G 4: 148,052,224 V446G probably damaging Het
Myh11 T C 16: 14,211,260 E1206G possibly damaging Het
Myo6 G A 9: 80,288,056 V903I probably damaging Het
Myo9b C T 8: 71,355,225 probably benign Het
Nr2f2 G C 7: 70,360,175 P52R probably damaging Het
Nsd3 A G 8: 25,683,257 N859S probably benign Het
Nucb2 C A 7: 116,536,010 A384E probably damaging Het
Ogdhl C A 14: 32,342,037 probably null Het
Olfr119 C A 17: 37,701,058 C129* probably null Het
Olfr1247 G A 2: 89,609,863 L80F probably damaging Het
Olfr1357 T C 10: 78,611,871 T257A probably benign Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr381 A T 11: 73,486,575 L83Q probably benign Het
Parp10 C T 15: 76,242,633 S145N probably benign Het
Pigh A G 12: 79,083,709 probably benign Het
Pigo A G 4: 43,023,824 probably benign Het
Pkp4 T A 2: 59,305,488 V199D possibly damaging Het
Polr1e C A 4: 45,025,143 probably null Het
Ppfia3 C A 7: 45,348,534 R723L probably damaging Het
Prex1 C A 2: 166,585,898 A945S possibly damaging Het
Prrt3 A T 6: 113,495,840 V457E probably damaging Het
Rab39 A G 9: 53,705,971 F49L possibly damaging Het
Rrs1 C A 1: 9,545,762 probably null Het
Rrs1 G A 1: 9,545,767 E82K probably damaging Het
Serpinb3c T C 1: 107,276,992 D8G probably benign Het
Slc17a6 A G 7: 51,646,180 probably benign Het
Slc24a4 T A 12: 102,228,951 probably null Het
Smc1b C T 15: 85,123,759 M272I probably benign Het
Smc6 T C 12: 11,283,178 probably benign Het
Tcf20 T C 15: 82,855,085 T722A probably benign Het
Tesmin A T 19: 3,404,088 M141L probably benign Het
Tmprss5 T A 9: 49,113,160 H274Q possibly damaging Het
Tns1 C T 1: 73,937,318 probably null Het
Tpr T C 1: 150,417,427 S868P possibly damaging Het
Trank1 C T 9: 111,366,253 T1115I probably damaging Het
Trmt44 A T 5: 35,572,917 I203K possibly damaging Het
Ulk2 A T 11: 61,777,785 V1037E probably benign Het
Usp43 A G 11: 67,876,499 Y682H probably damaging Het
Vipr2 A T 12: 116,142,882 Q366L probably damaging Het
Vmn1r185 C A 7: 26,611,589 V164L possibly damaging Het
Vmn2r120 C T 17: 57,525,052 V246I probably benign Het
Wdr66 T C 5: 123,283,447 V182A probably damaging Het
Wiz C T 17: 32,357,033 G790R probably damaging Het
Wnk1 A T 6: 119,952,733 S1016R probably damaging Het
Zc3hav1 A G 6: 38,311,174 L909S probably benign Het
Zfp236 T A 18: 82,640,227 I637F probably damaging Het
Zfp788 G A 7: 41,649,596 G532D probably damaging Het
Zranb1 T C 7: 132,950,385 I255T probably damaging Het
Other mutations in Igf2bp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02199:Igf2bp3 APN 6 49088524 missense probably benign 0.02
IGL02473:Igf2bp3 APN 6 49094229 missense probably benign 0.03
IGL02957:Igf2bp3 APN 6 49087404 missense probably benign 0.28
bittie UTSW 6 49107428 missense possibly damaging 0.61
bump UTSW 6 49117150 critical splice donor site probably benign
PIT4131001:Igf2bp3 UTSW 6 49117150 critical splice donor site probably null
PIT4142001:Igf2bp3 UTSW 6 49117383 missense probably damaging 0.98
R0541:Igf2bp3 UTSW 6 49107467 splice site probably benign
R1710:Igf2bp3 UTSW 6 49105631 missense probably damaging 1.00
R1764:Igf2bp3 UTSW 6 49109046 missense probably damaging 1.00
R2156:Igf2bp3 UTSW 6 49108924 critical splice donor site probably null
R2207:Igf2bp3 UTSW 6 49088554 missense possibly damaging 0.92
R5638:Igf2bp3 UTSW 6 49087800 missense probably damaging 1.00
R5899:Igf2bp3 UTSW 6 49117150 critical splice donor site probably benign
R6108:Igf2bp3 UTSW 6 49117374 missense probably damaging 1.00
R6243:Igf2bp3 UTSW 6 49107428 missense possibly damaging 0.61
R6340:Igf2bp3 UTSW 6 49214459 missense probably damaging 1.00
R6959:Igf2bp3 UTSW 6 49117148 splice site probably null
R7380:Igf2bp3 UTSW 6 49108999 missense probably benign 0.27
R7731:Igf2bp3 UTSW 6 49134731 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGTGTATCAAGAAGCCAAGGCTCG -3'
(R):5'- AGCTGAATGACTGTCACCTGTCCTC -3'

Sequencing Primer
(F):5'- AGGCTCGGAAGCTACCTAATTTG -3'
(R):5'- GTCACCTGTCCTCCTGACATTC -3'
Posted On2013-05-09