Mutagenetix > Incidental Mutation

Incidental Mutation 'R4549:Gnpda2'

333891

Institutional Source

Beutler Lab

Gene Symbol

Gnpda2

Ensembl Gene

ENSMUSG00000029209

Gene Name

glucosamine-6-phosphate deaminase 2

Synonyms

4933412A11Rik, 4921523I18Rik, Gnp2

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4549 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

69732344-69749684 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 69743872 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 54 (E54D)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031117] [ENSMUST00000120789] [ENSMUST00000139632] [ENSMUST00000153536] [ENSMUST00000166298] [ENSMUST00000173927]

AlphaFold

Q9CRC9

Predicted Effect

probably benign
Transcript: ENSMUST00000031117
AA Change: E54D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000031117
Gene: ENSMUSG00000029209
AA Change: E54D

Domain	Start	End	E-Value	Type
Pfam:Glucosamine_iso	7	237	2.9e-23	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000120789
AA Change: E54D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000112484
Gene: ENSMUSG00000029209
AA Change: E54D

Domain	Start	End	E-Value	Type
Pfam:Glucosamine_iso	12	217	3.7e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000139632
AA Change: E54D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000121014
Gene: ENSMUSG00000029209
AA Change: E54D

Domain	Start	End	E-Value	Type
Pfam:Glucosamine_iso	12	217	1.1e-25	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000153536

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154018

Predicted Effect

probably benign
Transcript: ENSMUST00000166298
AA Change: E54D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000128233
Gene: ENSMUSG00000029209
AA Change: E54D

Domain	Start	End	E-Value	Type
Pfam:Glucosamine_iso	12	215	5.4e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000173927
AA Change: E54D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000133490
Gene: ENSMUSG00000029209
AA Change: E54D

Domain	Start	End	E-Value	Type
Pfam:Glucosamine_iso	12	215	5.4e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000174233
AA Change: E54D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000133670
Gene: ENSMUSG00000029209
AA Change: E54D

Domain	Start	End	E-Value	Type
Pfam:Glucosamine_iso	12	169	3.7e-18	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an allosteric enzyme that catalyzes the reversible reaction converting D-glucosamine-6-phosphate into D-fructose-6-phosphate and ammonium. Variations of this gene have been reported to be associated with influencing body mass index and susceptibility to obesity. A pseudogene of this gene is located on chromosome 9. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]

Allele List at MGI

Other mutations in this stock

Total: 20 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adpgk	G	A	9: 59,217,511 (GRCm39)	V175I	probably damaging	Het
Aldh7a1	A	G	18: 56,665,066 (GRCm39)	V371A	probably benign	Het
Ankrd60	T	A	2: 173,414,395 (GRCm39)	T125S	possibly damaging	Het
Ap1m1	T	A	8: 72,994,064 (GRCm39)	Y7N	probably damaging	Het
Carmil3	G	A	14: 55,743,121 (GRCm39)		probably null	Het
Fsip2	T	A	2: 82,819,972 (GRCm39)	L5235H	probably damaging	Het
Galnt17	A	G	5: 131,179,775 (GRCm39)	L124P	probably damaging	Het
Kcnd3	C	T	3: 105,566,082 (GRCm39)	A421V	probably damaging	Het
Ly6f	T	A	15: 75,143,579 (GRCm39)	N95K	probably benign	Het
Macf1	T	C	4: 123,367,486 (GRCm39)	D2425G	possibly damaging	Het
Prkdc	G	A	16: 15,554,734 (GRCm39)	E2152K	possibly damaging	Het
Serpinb6e	T	A	13: 34,017,214 (GRCm39)	T269S	possibly damaging	Het
Smg1	A	G	7: 117,758,906 (GRCm39)		probably benign	Het
Snapc1	C	A	12: 74,017,053 (GRCm39)	D9E	probably damaging	Het
Syt8	G	T	7: 141,993,199 (GRCm39)	V35L	probably benign	Het
Top2b	T	G	14: 16,409,189 (GRCm38)	I777M	probably damaging	Het
Trappc10	T	C	10: 78,067,292 (GRCm39)	R49G	probably damaging	Het
Vmn1r81	A	T	7: 11,993,749 (GRCm39)	F286L	probably damaging	Het
Vwa5a	A	T	9: 38,649,221 (GRCm39)	K656N	probably benign	Het
Zfp438	A	G	18: 5,214,073 (GRCm39)	V295A	probably benign	Het

Other mutations in Gnpda2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0566:Gnpda2	UTSW	5	69,742,304 (GRCm39)	splice site	probably benign
R3611:Gnpda2	UTSW	5	69,734,752 (GRCm39)	missense	probably benign
R5538:Gnpda2	UTSW	5	69,735,394 (GRCm39)	missense	probably damaging	1.00
R8744:Gnpda2	UTSW	5	69,735,459 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGCAGAATGAATGCATATCTCC -3'
(R):5'- AAGCTGCCTCAATCTGTCATG -3'

Sequencing Primer
(F):5'- CAAGTTGTATATCCCGTTACACTGTG -3'
(R):5'- GCCTCAATCTGTCATGAACATTG -3'

Posted On

2015-08-18