Incidental Mutation 'R4549:Vmn1r81'
ID333893
Institutional Source Beutler Lab
Gene Symbol Vmn1r81
Ensembl Gene ENSMUSG00000115027
Gene Namevomeronasal 1 receptor 81
SynonymsV1rg9
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.837) question?
Stock #R4549 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location12247241-12268269 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12259822 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 286 (F286L)
Ref Sequence ENSEMBL: ENSMUSP00000153767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086232] [ENSMUST00000227080] [ENSMUST00000227973] [ENSMUST00000228482] [ENSMUST00000228764]
Predicted Effect probably damaging
Transcript: ENSMUST00000086232
AA Change: F286L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000083409
Gene: ENSMUSG00000115027
AA Change: F286L

DomainStartEndE-ValueType
Pfam:TAS2R 3 301 5.4e-12 PFAM
Pfam:V1R 34 299 6.6e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227080
Predicted Effect probably damaging
Transcript: ENSMUST00000227973
AA Change: F286L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000228482
Predicted Effect probably damaging
Transcript: ENSMUST00000228764
AA Change: F286L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adpgk G A 9: 59,310,228 V175I probably damaging Het
Aldh7a1 A G 18: 56,531,994 V371A probably benign Het
Ankrd60 T A 2: 173,572,602 T125S possibly damaging Het
Ap1m1 T A 8: 72,240,220 Y7N probably damaging Het
Carmil3 G A 14: 55,505,664 probably null Het
Fsip2 T A 2: 82,989,628 L5235H probably damaging Het
Galnt17 A G 5: 131,150,937 L124P probably damaging Het
Gnpda2 T A 5: 69,586,529 E54D probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Ly6f T A 15: 75,271,730 N95K probably benign Het
Macf1 T C 4: 123,473,693 D2425G possibly damaging Het
Prkdc G A 16: 15,736,870 E2152K possibly damaging Het
Serpinb6e T A 13: 33,833,231 T269S possibly damaging Het
Smg1 A G 7: 118,159,683 probably benign Het
Snapc1 C A 12: 73,970,279 D9E probably damaging Het
Syt8 G T 7: 142,439,462 V35L probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trappc10 T C 10: 78,231,458 R49G probably damaging Het
Vwa5a A T 9: 38,737,925 K656N probably benign Het
Zfp438 A G 18: 5,214,073 V295A probably benign Het
Other mutations in Vmn1r81
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02026:Vmn1r81 APN 7 12260505 missense probably damaging 1.00
IGL02086:Vmn1r81 APN 7 12259865 missense possibly damaging 0.82
IGL02751:Vmn1r81 APN 7 12260447 missense probably damaging 1.00
IGL02879:Vmn1r81 APN 7 12260392 missense probably benign 0.20
IGL03358:Vmn1r81 APN 7 12260305 missense possibly damaging 0.57
PIT4305001:Vmn1r81 UTSW 7 12260663 missense probably benign 0.01
R0359:Vmn1r81 UTSW 7 12259950 missense probably damaging 1.00
R1615:Vmn1r81 UTSW 7 12260514 missense probably damaging 1.00
R1938:Vmn1r81 UTSW 7 12260662 missense possibly damaging 0.67
R2967:Vmn1r81 UTSW 7 12260037 missense probably damaging 0.99
R2983:Vmn1r81 UTSW 7 12260669 missense probably benign 0.02
R5099:Vmn1r81 UTSW 7 12260321 missense possibly damaging 0.86
R5326:Vmn1r81 UTSW 7 12260107 missense probably damaging 1.00
R5542:Vmn1r81 UTSW 7 12260107 missense probably damaging 1.00
R6010:Vmn1r81 UTSW 7 12260422 missense possibly damaging 0.88
R6630:Vmn1r81 UTSW 7 12260657 nonsense probably null
R6724:Vmn1r81 UTSW 7 12260672 missense probably damaging 1.00
R6754:Vmn1r81 UTSW 7 12259847 missense probably damaging 0.98
R8198:Vmn1r81 UTSW 7 12259955 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- AGTTCCCAGATGTATTTTCTCCTAG -3'
(R):5'- TTCTGAAAGTCTCGCCTGAGG -3'

Sequencing Primer
(F):5'- AGATGTATTTTCTCCTAGTCTCCTAC -3'
(R):5'- GCCTGAGGACAGAGCTACAC -3'
Posted On2015-08-18