Mutagenetix > Incidental Mutation

Incidental Mutation 'R4549:Syt8'

333895

Institutional Source

Beutler Lab

Gene Symbol

Syt8

Ensembl Gene

ENSMUSG00000031098

Gene Name

synaptotagmin VIII

Synonyms

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.066) question?

Stock #

R4549 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

141988587-141994133 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 141993199 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 35 (V35L)

Ref Sequence

ENSEMBL: ENSMUSP00000147572 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097939] [ENSMUST00000105971] [ENSMUST00000105973] [ENSMUST00000105976] [ENSMUST00000105977] [ENSMUST00000118276] [ENSMUST00000122393] [ENSMUST00000210746] [ENSMUST00000210239] [ENSMUST00000145287] [ENSMUST00000149529]

AlphaFold

Q9R0N6

Predicted Effect

probably benign
Transcript: ENSMUST00000097939
AA Change: V213L

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000095552
Gene: ENSMUSG00000031098
AA Change: V213L

Domain	Start	End	E-Value	Type
transmembrane domain	37	59	N/A	INTRINSIC
C2	123	222	1.86e-15	SMART
C2	251	361	8.69e-16	SMART
low complexity region	380	388	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000105971

SMART Domains

Protein: ENSMUSP00000101591
Gene: ENSMUSG00000031097

Domain	Start	End	E-Value	Type
Pfam:Troponin	15	145	1.1e-54	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000105973

SMART Domains

Protein: ENSMUSP00000101593
Gene: ENSMUSG00000031097

Domain	Start	End	E-Value	Type
Pfam:Troponin	10	153	1.9e-49	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000105976
AA Change: V213L

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000101596
Gene: ENSMUSG00000031098
AA Change: V213L

Domain	Start	End	E-Value	Type
transmembrane domain	37	59	N/A	INTRINSIC
C2	123	222	1.86e-15	SMART
C2	251	361	8.69e-16	SMART
low complexity region	380	388	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000105977

SMART Domains

Protein: ENSMUSP00000101597
Gene: ENSMUSG00000031098

Domain	Start	End	E-Value	Type
Pfam:UPF0560	14	88	2.7e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000118276
AA Change: V219L

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000113545
Gene: ENSMUSG00000031098
AA Change: V219L

Domain	Start	End	E-Value	Type
transmembrane domain	43	65	N/A	INTRINSIC
C2	129	228	1.86e-15	SMART
C2	257	367	8.69e-16	SMART
low complexity region	386	394	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000122393
AA Change: V219L

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000112689
Gene: ENSMUSG00000031098
AA Change: V219L

Domain	Start	End	E-Value	Type
transmembrane domain	43	65	N/A	INTRINSIC
C2	129	228	1.86e-15	SMART
C2	257	367	8.69e-16	SMART
low complexity region	386	394	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150192

Predicted Effect

probably benign
Transcript: ENSMUST00000210746
AA Change: V35L

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148896

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131034

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211192

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145964

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128481

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124963

Predicted Effect

probably benign
Transcript: ENSMUST00000210239

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129618

Predicted Effect

probably benign
Transcript: ENSMUST00000145287

SMART Domains

Protein: ENSMUSP00000121819
Gene: ENSMUSG00000031097

Domain	Start	End	E-Value	Type
Pfam:Troponin	15	135	4.2e-49	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000149529

SMART Domains

Protein: ENSMUSP00000122733
Gene: ENSMUSG00000031097

Domain	Start	End	E-Value	Type
Pfam:Troponin	15	145	1.1e-54	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the synaptotagmin protein family. Synaptotagmins are membrane proteins that are important in neurotransmission and hormone secretion, both of which involve regulated exocytosis. Expression of the encoded protein in human pancreatic islets has been connected to activity of the promoter for the insulin gene, on the same chromosome several hundred kilobases away (PMID: 21336277 and 22928559). This association would link response to gluclose to insulin secretion. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]

Allele List at MGI

Other mutations in this stock

Total: 20 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adpgk	G	A	9: 59,217,511 (GRCm39)	V175I	probably damaging	Het
Aldh7a1	A	G	18: 56,665,066 (GRCm39)	V371A	probably benign	Het
Ankrd60	T	A	2: 173,414,395 (GRCm39)	T125S	possibly damaging	Het
Ap1m1	T	A	8: 72,994,064 (GRCm39)	Y7N	probably damaging	Het
Carmil3	G	A	14: 55,743,121 (GRCm39)		probably null	Het
Fsip2	T	A	2: 82,819,972 (GRCm39)	L5235H	probably damaging	Het
Galnt17	A	G	5: 131,179,775 (GRCm39)	L124P	probably damaging	Het
Gnpda2	T	A	5: 69,743,872 (GRCm39)	E54D	probably benign	Het
Kcnd3	C	T	3: 105,566,082 (GRCm39)	A421V	probably damaging	Het
Ly6f	T	A	15: 75,143,579 (GRCm39)	N95K	probably benign	Het
Macf1	T	C	4: 123,367,486 (GRCm39)	D2425G	possibly damaging	Het
Prkdc	G	A	16: 15,554,734 (GRCm39)	E2152K	possibly damaging	Het
Serpinb6e	T	A	13: 34,017,214 (GRCm39)	T269S	possibly damaging	Het
Smg1	A	G	7: 117,758,906 (GRCm39)		probably benign	Het
Snapc1	C	A	12: 74,017,053 (GRCm39)	D9E	probably damaging	Het
Top2b	T	G	14: 16,409,189 (GRCm38)	I777M	probably damaging	Het
Trappc10	T	C	10: 78,067,292 (GRCm39)	R49G	probably damaging	Het
Vmn1r81	A	T	7: 11,993,749 (GRCm39)	F286L	probably damaging	Het
Vwa5a	A	T	9: 38,649,221 (GRCm39)	K656N	probably benign	Het
Zfp438	A	G	18: 5,214,073 (GRCm39)	V295A	probably benign	Het

Other mutations in Syt8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01980:Syt8	APN	7	141,993,877 (GRCm39)	missense	probably damaging	1.00
R0032:Syt8	UTSW	7	141,992,926 (GRCm39)	missense	probably benign	0.00
R0032:Syt8	UTSW	7	141,992,926 (GRCm39)	missense	probably benign	0.00
R1819:Syt8	UTSW	7	141,991,971 (GRCm39)	missense	possibly damaging	0.81
R4550:Syt8	UTSW	7	141,993,199 (GRCm39)	missense	probably benign	0.13
R6964:Syt8	UTSW	7	141,993,158 (GRCm39)	missense	probably benign	0.00
R8008:Syt8	UTSW	7	141,992,259 (GRCm39)	missense	probably benign	0.00
R8052:Syt8	UTSW	7	141,993,881 (GRCm39)	missense	probably damaging	0.97
R8139:Syt8	UTSW	7	141,992,005 (GRCm39)	missense	probably benign	0.01
R9574:Syt8	UTSW	7	141,993,203 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGAGACATGCTGCTTTCTGG -3'
(R):5'- CAGGCTATGGGCAACAAGAC -3'

Sequencing Primer
(F):5'- AGAGACATGCTGCTTTCTGGTAAGTC -3'
(R):5'- CAAGACGGGGCTGCAACTG -3'

Posted On

2015-08-18