Incidental Mutation 'R4549:Snapc1'
ID333900
Institutional Source Beutler Lab
Gene Symbol Snapc1
Ensembl Gene ENSMUSG00000021113
Gene Namesmall nuclear RNA activating complex, polypeptide 1
Synonyms2700033G17Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4549 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location73964481-73988966 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 73970279 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 9 (D9E)
Ref Sequence ENSEMBL: ENSMUSP00000152248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021532] [ENSMUST00000220882] [ENSMUST00000221556] [ENSMUST00000222025]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021532
AA Change: D230E

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000021532
Gene: ENSMUSG00000021113
AA Change: D230E

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:SNAPc_SNAP43 26 210 4.5e-65 PFAM
low complexity region 261 273 N/A INTRINSIC
low complexity region 307 316 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000220882
AA Change: D9E

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000220909
Predicted Effect probably benign
Transcript: ENSMUST00000221556
Predicted Effect probably benign
Transcript: ENSMUST00000221833
Predicted Effect probably benign
Transcript: ENSMUST00000222025
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adpgk G A 9: 59,310,228 V175I probably damaging Het
Aldh7a1 A G 18: 56,531,994 V371A probably benign Het
Ankrd60 T A 2: 173,572,602 T125S possibly damaging Het
Ap1m1 T A 8: 72,240,220 Y7N probably damaging Het
Carmil3 G A 14: 55,505,664 probably null Het
Fsip2 T A 2: 82,989,628 L5235H probably damaging Het
Galnt17 A G 5: 131,150,937 L124P probably damaging Het
Gnpda2 T A 5: 69,586,529 E54D probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Ly6f T A 15: 75,271,730 N95K probably benign Het
Macf1 T C 4: 123,473,693 D2425G possibly damaging Het
Prkdc G A 16: 15,736,870 E2152K possibly damaging Het
Serpinb6e T A 13: 33,833,231 T269S possibly damaging Het
Smg1 A G 7: 118,159,683 probably benign Het
Syt8 G T 7: 142,439,462 V35L probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trappc10 T C 10: 78,231,458 R49G probably damaging Het
Vmn1r81 A T 7: 12,259,822 F286L probably damaging Het
Vwa5a A T 9: 38,737,925 K656N probably benign Het
Zfp438 A G 18: 5,214,073 V295A probably benign Het
Other mutations in Snapc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Snapc1 APN 12 73968374 splice site probably null
IGL00529:Snapc1 APN 12 73964655 missense probably benign 0.00
IGL00676:Snapc1 APN 12 73971913 missense probably damaging 1.00
IGL01373:Snapc1 APN 12 73964680 missense probably benign 0.00
IGL02060:Snapc1 APN 12 73968036 missense probably damaging 1.00
IGL02309:Snapc1 APN 12 73968027 missense probably damaging 1.00
IGL02653:Snapc1 APN 12 73982487 missense probably benign 0.00
IGL02686:Snapc1 APN 12 73964596 intron probably benign
IGL03160:Snapc1 APN 12 73970204 missense probably damaging 1.00
PIT4362001:Snapc1 UTSW 12 73982495 missense probably damaging 0.98
R0056:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0057:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0057:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0113:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0152:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0153:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0244:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0245:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0316:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0318:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0352:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0646:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0841:Snapc1 UTSW 12 73975006 splice site probably benign
R2188:Snapc1 UTSW 12 73970227 missense probably damaging 1.00
R2483:Snapc1 UTSW 12 73964643 missense probably benign 0.02
R4165:Snapc1 UTSW 12 73982580 critical splice donor site probably null
R4169:Snapc1 UTSW 12 73982491 missense probably benign 0.00
R4550:Snapc1 UTSW 12 73970279 missense probably damaging 0.97
R4658:Snapc1 UTSW 12 73983868 missense possibly damaging 0.75
R6976:Snapc1 UTSW 12 73970200 missense probably damaging 1.00
R7432:Snapc1 UTSW 12 73968294 missense probably benign 0.01
R7488:Snapc1 UTSW 12 73982511 missense probably benign 0.39
R8507:Snapc1 UTSW 12 73964732 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCTACACTTCCAACCAGC -3'
(R):5'- AACGCCCTCTGAATCTTGAC -3'

Sequencing Primer
(F):5'- TGGGCCACATACGAAGACACTG -3'
(R):5'- CTGAATCTTGACTCCACAGCAATGTG -3'
Posted On2015-08-18