Mutagenetix > Incidental Mutation

Incidental Mutation 'R4549:Top2b'

333902

Institutional Source

Beutler Lab

Gene Symbol

Top2b

Ensembl Gene

ENSMUSG00000017485

Gene Name

topoisomerase (DNA) II beta

Synonyms

D230016L12Rik, Top-2

Accession Numbers

Essential gene?

Probably essential (E-score: 0.888) question?

Stock #

R4549 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

16365179-16435462 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 16409189 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 777 (I777M)

Ref Sequence

ENSEMBL: ENSMUSP00000017629 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017629] [ENSMUST00000161693]

AlphaFold

Q64511

Predicted Effect

probably damaging
Transcript: ENSMUST00000017629
AA Change: I777M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000017629
Gene: ENSMUSG00000017485
AA Change: I777M

Domain	Start	End	E-Value	Type
Blast:TOP2c	32	70	7e-10	BLAST
HATPase_c	85	234	1.91e-2	SMART
TOP2c	89	679	N/A	SMART
TOP4c	702	1175	2.55e-230	SMART
low complexity region	1201	1215	N/A	INTRINSIC
low complexity region	1287	1299	N/A	INTRINSIC
low complexity region	1324	1336	N/A	INTRINSIC
low complexity region	1360	1382	N/A	INTRINSIC
Pfam:DTHCT	1495	1597	4.6e-31	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159302

SMART Domains

Protein: ENSMUSP00000123789
Gene: ENSMUSG00000017485

Domain	Start	End	E-Value	Type
TOP4c	1	177	4.06e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000160501

SMART Domains

Protein: ENSMUSP00000124889
Gene: ENSMUSG00000017485

Domain	Start	End	E-Value	Type
TOP4c	2	222	3.97e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000161693

SMART Domains

Protein: ENSMUSP00000123992
Gene: ENSMUSG00000017485

Domain	Start	End	E-Value	Type
Pfam:DNA_topoisoIV	1	117	1.2e-12	PFAM
low complexity region	161	173	N/A	INTRINSIC
low complexity region	198	210	N/A	INTRINSIC
low complexity region	234	256	N/A	INTRINSIC

Meta Mutation Damage Score

0.8018

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, beta, is localized to chromosome 3 and the alpha form is localized to chromosome 17. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice exhibit abnormal innervation. Offspring die shortly after birth due to respiratory failure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 20 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adpgk	G	A	9: 59,310,228 (GRCm38)	V175I	probably damaging	Het
Aldh7a1	A	G	18: 56,531,994 (GRCm38)	V371A	probably benign	Het
Ankrd60	T	A	2: 173,572,602 (GRCm38)	T125S	possibly damaging	Het
Ap1m1	T	A	8: 72,240,220 (GRCm38)	Y7N	probably damaging	Het
Carmil3	G	A	14: 55,505,664 (GRCm38)		probably null	Het
Fsip2	T	A	2: 82,989,628 (GRCm38)	L5235H	probably damaging	Het
Galnt17	A	G	5: 131,150,937 (GRCm38)	L124P	probably damaging	Het
Gnpda2	T	A	5: 69,586,529 (GRCm38)	E54D	probably benign	Het
Kcnd3	C	T	3: 105,658,766 (GRCm38)	A421V	probably damaging	Het
Ly6f	T	A	15: 75,271,730 (GRCm38)	N95K	probably benign	Het
Macf1	T	C	4: 123,473,693 (GRCm38)	D2425G	possibly damaging	Het
Prkdc	G	A	16: 15,736,870 (GRCm38)	E2152K	possibly damaging	Het
Serpinb6e	T	A	13: 33,833,231 (GRCm38)	T269S	possibly damaging	Het
Smg1	A	G	7: 118,159,683 (GRCm38)		probably benign	Het
Snapc1	C	A	12: 73,970,279 (GRCm38)	D9E	probably damaging	Het
Syt8	G	T	7: 142,439,462 (GRCm38)	V35L	probably benign	Het
Trappc10	T	C	10: 78,231,458 (GRCm38)	R49G	probably damaging	Het
Vmn1r81	A	T	7: 12,259,822 (GRCm38)	F286L	probably damaging	Het
Vwa5a	A	T	9: 38,737,925 (GRCm38)	K656N	probably benign	Het
Zfp438	A	G	18: 5,214,073 (GRCm38)	V295A	probably benign	Het

Other mutations in Top2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Top2b	APN	14	16,422,692 (GRCm38)	missense	probably benign	0.00
IGL00730:Top2b	APN	14	16,389,831 (GRCm38)	missense	probably damaging	1.00
IGL00917:Top2b	APN	14	16,407,354 (GRCm38)	missense	probably benign	0.05
IGL01959:Top2b	APN	14	16,422,695 (GRCm38)	missense	probably benign	0.19
IGL02019:Top2b	APN	14	16,409,965 (GRCm38)	missense	probably benign	0.44
IGL02119:Top2b	APN	14	16,406,733 (GRCm38)	missense	probably damaging	1.00
IGL02136:Top2b	APN	14	16,407,103 (GRCm38)	unclassified	probably benign
IGL02148:Top2b	APN	14	16,400,488 (GRCm38)	missense	probably damaging	1.00
IGL02496:Top2b	APN	14	16,387,335 (GRCm38)	missense	probably benign
IGL02503:Top2b	APN	14	16,407,163 (GRCm38)	missense	possibly damaging	0.92
IGL02672:Top2b	APN	14	16,409,166 (GRCm38)	unclassified	probably benign
IGL02721:Top2b	APN	14	16,409,236 (GRCm38)	missense	probably damaging	1.00
IGL02886:Top2b	APN	14	16,365,688 (GRCm38)	missense	possibly damaging	0.73
IGL03252:Top2b	APN	14	16,393,163 (GRCm38)	missense	possibly damaging	0.60
PIT4434001:Top2b	UTSW	14	16,423,780 (GRCm38)	critical splice donor site	probably null
R0092:Top2b	UTSW	14	16,409,263 (GRCm38)	missense	probably damaging	1.00
R0201:Top2b	UTSW	14	16,383,174 (GRCm38)	missense	probably damaging	1.00
R0390:Top2b	UTSW	14	16,418,442 (GRCm38)	missense	probably benign	0.00
R0394:Top2b	UTSW	14	16,413,556 (GRCm38)	splice site	probably null
R1159:Top2b	UTSW	14	16,430,329 (GRCm38)	missense	possibly damaging	0.81
R1424:Top2b	UTSW	14	16,383,177 (GRCm38)	missense	probably damaging	1.00
R1519:Top2b	UTSW	14	16,408,953 (GRCm38)	splice site	probably null
R1561:Top2b	UTSW	14	16,398,993 (GRCm38)	missense	possibly damaging	0.80
R1713:Top2b	UTSW	14	16,409,823 (GRCm38)	missense	probably benign	0.05
R1987:Top2b	UTSW	14	16,398,916 (GRCm38)	missense	probably damaging	0.99
R2219:Top2b	UTSW	14	16,409,189 (GRCm38)	missense	probably damaging	1.00
R2287:Top2b	UTSW	14	16,409,189 (GRCm38)	missense	probably damaging	1.00
R2422:Top2b	UTSW	14	16,409,189 (GRCm38)	missense	probably damaging	1.00
R2679:Top2b	UTSW	14	16,413,947 (GRCm38)	missense	probably damaging	1.00
R3687:Top2b	UTSW	14	16,409,189 (GRCm38)	missense	probably damaging	1.00
R3707:Top2b	UTSW	14	16,388,447 (GRCm38)	missense	probably damaging	1.00
R3810:Top2b	UTSW	14	16,409,189 (GRCm38)	missense	probably damaging	1.00
R3812:Top2b	UTSW	14	16,409,189 (GRCm38)	missense	probably damaging	1.00
R3815:Top2b	UTSW	14	16,409,189 (GRCm38)	missense	probably damaging	1.00
R3816:Top2b	UTSW	14	16,409,189 (GRCm38)	missense	probably damaging	1.00
R3818:Top2b	UTSW	14	16,409,189 (GRCm38)	missense	probably damaging	1.00
R4023:Top2b	UTSW	14	16,409,189 (GRCm38)	missense	probably damaging	1.00
R4025:Top2b	UTSW	14	16,409,189 (GRCm38)	missense	probably damaging	1.00
R4026:Top2b	UTSW	14	16,409,189 (GRCm38)	missense	probably damaging	1.00
R4133:Top2b	UTSW	14	16,409,189 (GRCm38)	missense	probably damaging	1.00
R4157:Top2b	UTSW	14	16,384,491 (GRCm38)	missense	probably benign	0.42
R4179:Top2b	UTSW	14	16,409,189 (GRCm38)	missense	probably damaging	1.00
R4180:Top2b	UTSW	14	16,409,189 (GRCm38)	missense	probably damaging	1.00
R4300:Top2b	UTSW	14	16,409,189 (GRCm38)	missense	probably damaging	1.00
R4376:Top2b	UTSW	14	16,409,189 (GRCm38)	missense	probably damaging	1.00
R4377:Top2b	UTSW	14	16,409,189 (GRCm38)	missense	probably damaging	1.00
R4492:Top2b	UTSW	14	16,409,189 (GRCm38)	missense	probably damaging	1.00
R4550:Top2b	UTSW	14	16,409,189 (GRCm38)	missense	probably damaging	1.00
R4581:Top2b	UTSW	14	16,409,189 (GRCm38)	missense	probably damaging	1.00
R4582:Top2b	UTSW	14	16,409,189 (GRCm38)	missense	probably damaging	1.00
R4628:Top2b	UTSW	14	16,409,189 (GRCm38)	missense	probably damaging	1.00
R4630:Top2b	UTSW	14	16,409,189 (GRCm38)	missense	probably damaging	1.00
R4667:Top2b	UTSW	14	16,409,189 (GRCm38)	missense	probably damaging	1.00
R4668:Top2b	UTSW	14	16,409,189 (GRCm38)	missense	probably damaging	1.00
R4669:Top2b	UTSW	14	16,409,189 (GRCm38)	missense	probably damaging	1.00
R4698:Top2b	UTSW	14	16,387,331 (GRCm38)	nonsense	probably null
R4769:Top2b	UTSW	14	16,398,991 (GRCm38)	missense	probably damaging	1.00
R4809:Top2b	UTSW	14	16,383,125 (GRCm38)	missense	probably benign	0.06
R4899:Top2b	UTSW	14	16,387,313 (GRCm38)	missense	probably damaging	1.00
R5035:Top2b	UTSW	14	16,409,966 (GRCm38)	missense	probably benign	0.01
R5621:Top2b	UTSW	14	16,387,280 (GRCm38)	missense	probably damaging	1.00
R5631:Top2b	UTSW	14	16,409,882 (GRCm38)	missense	probably damaging	1.00
R5685:Top2b	UTSW	14	16,413,666 (GRCm38)	missense	probably damaging	1.00
R5732:Top2b	UTSW	14	16,400,106 (GRCm38)	missense	possibly damaging	0.92
R5939:Top2b	UTSW	14	16,422,786 (GRCm38)	missense	probably damaging	0.96
R6007:Top2b	UTSW	14	16,423,779 (GRCm38)	critical splice donor site	probably null
R6087:Top2b	UTSW	14	16,409,864 (GRCm38)	missense	probably benign	0.14
R6144:Top2b	UTSW	14	16,423,740 (GRCm38)	missense	possibly damaging	0.48
R6196:Top2b	UTSW	14	16,409,189 (GRCm38)	missense	probably damaging	1.00
R6218:Top2b	UTSW	14	16,409,189 (GRCm38)	missense	probably damaging	1.00
R6229:Top2b	UTSW	14	16,409,838 (GRCm38)	missense	probably damaging	1.00
R6249:Top2b	UTSW	14	16,399,006 (GRCm38)	missense	probably damaging	1.00
R6337:Top2b	UTSW	14	16,399,026 (GRCm38)	missense	possibly damaging	0.77
R6353:Top2b	UTSW	14	16,416,671 (GRCm38)	missense	probably damaging	1.00
R6512:Top2b	UTSW	14	16,409,854 (GRCm38)	missense	possibly damaging	0.94
R6573:Top2b	UTSW	14	16,398,991 (GRCm38)	missense	probably damaging	1.00
R6614:Top2b	UTSW	14	16,407,142 (GRCm38)	nonsense	probably null
R6844:Top2b	UTSW	14	16,429,383 (GRCm38)	missense	possibly damaging	0.94
R6848:Top2b	UTSW	14	16,409,958 (GRCm38)	missense	possibly damaging	0.89
R6871:Top2b	UTSW	14	16,409,189 (GRCm38)	missense	probably damaging	1.00
R6895:Top2b	UTSW	14	16,413,604 (GRCm38)	missense	probably benign	0.06
R7162:Top2b	UTSW	14	16,416,653 (GRCm38)	missense	probably benign	0.00
R7247:Top2b	UTSW	14	16,416,962 (GRCm38)	missense	probably benign	0.08
R7250:Top2b	UTSW	14	16,420,411 (GRCm38)	missense	probably benign
R7359:Top2b	UTSW	14	16,407,376 (GRCm38)	missense	probably null	1.00
R7365:Top2b	UTSW	14	16,416,649 (GRCm38)	missense	probably benign	0.04
R7493:Top2b	UTSW	14	16,416,605 (GRCm38)	missense	probably benign	0.00
R7528:Top2b	UTSW	14	16,395,427 (GRCm38)	nonsense	probably null
R7562:Top2b	UTSW	14	16,412,946 (GRCm38)	missense	probably benign	0.04
R7594:Top2b	UTSW	14	16,428,587 (GRCm38)	missense	probably benign
R7670:Top2b	UTSW	14	16,416,620 (GRCm38)	missense	possibly damaging	0.61
R7894:Top2b	UTSW	14	16,413,081 (GRCm38)	missense	possibly damaging	0.68
R8031:Top2b	UTSW	14	16,412,986 (GRCm38)	missense	probably damaging	0.98
R8150:Top2b	UTSW	14	16,393,291 (GRCm38)	missense	probably damaging	0.99
R8214:Top2b	UTSW	14	16,383,177 (GRCm38)	missense	probably damaging	1.00
R8299:Top2b	UTSW	14	16,386,123 (GRCm38)	missense	possibly damaging	0.68
R8977:Top2b	UTSW	14	16,393,239 (GRCm38)	missense	probably benign	0.36
R9562:Top2b	UTSW	14	16,365,718 (GRCm38)	missense	probably benign	0.09
R9565:Top2b	UTSW	14	16,365,718 (GRCm38)	missense	probably benign	0.09
R9798:Top2b	UTSW	14	16,389,845 (GRCm38)	missense	probably damaging	1.00
X0028:Top2b	UTSW	14	16,384,499 (GRCm38)	nonsense	probably null
Z1176:Top2b	UTSW	14	16,395,434 (GRCm38)	missense	probably damaging	1.00
Z1177:Top2b	UTSW	14	16,416,953 (GRCm38)	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCACTGAAGATGGGATCAACTG -3'
(R):5'- ATTTGAAGTACTCTCCCTGAGC -3'

Sequencing Primer
(F):5'- CTGAAGATGGGATCAACTGAGAACTG -3'
(R):5'- TCTCCCTGAGCAGAAAAACTAAATG -3'

Posted On

2015-08-18