Incidental Mutation 'R4549:Ly6f'
ID333904
Institutional Source Beutler Lab
Gene Symbol Ly6f
Ensembl Gene ENSMUSG00000022583
Gene Namelymphocyte antigen 6 complex, locus F
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R4549 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location75268421-75272235 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75271730 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 95 (N95K)
Ref Sequence ENSEMBL: ENSMUSP00000140899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023247] [ENSMUST00000189654]
Predicted Effect probably benign
Transcript: ENSMUST00000023247
AA Change: N95K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023247
Gene: ENSMUSG00000022583
AA Change: N95K

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 118 1.94e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189654
AA Change: N95K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140899
Gene: ENSMUSG00000022583
AA Change: N95K

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 118 1.94e-35 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adpgk G A 9: 59,310,228 V175I probably damaging Het
Aldh7a1 A G 18: 56,531,994 V371A probably benign Het
Ankrd60 T A 2: 173,572,602 T125S possibly damaging Het
Ap1m1 T A 8: 72,240,220 Y7N probably damaging Het
Carmil3 G A 14: 55,505,664 probably null Het
Fsip2 T A 2: 82,989,628 L5235H probably damaging Het
Galnt17 A G 5: 131,150,937 L124P probably damaging Het
Gnpda2 T A 5: 69,586,529 E54D probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Macf1 T C 4: 123,473,693 D2425G possibly damaging Het
Prkdc G A 16: 15,736,870 E2152K possibly damaging Het
Serpinb6e T A 13: 33,833,231 T269S possibly damaging Het
Smg1 A G 7: 118,159,683 probably benign Het
Snapc1 C A 12: 73,970,279 D9E probably damaging Het
Syt8 G T 7: 142,439,462 V35L probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trappc10 T C 10: 78,231,458 R49G probably damaging Het
Vmn1r81 A T 7: 12,259,822 F286L probably damaging Het
Vwa5a A T 9: 38,737,925 K656N probably benign Het
Zfp438 A G 18: 5,214,073 V295A probably benign Het
Other mutations in Ly6f
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0480:Ly6f UTSW 15 75271677 missense probably damaging 1.00
R1084:Ly6f UTSW 15 75268773 missense probably damaging 1.00
R3036:Ly6f UTSW 15 75268787 missense probably damaging 1.00
R3113:Ly6f UTSW 15 75271728 missense probably benign 0.28
R4824:Ly6f UTSW 15 75271720 missense probably damaging 0.99
R5148:Ly6f UTSW 15 75271797 missense probably benign
R5211:Ly6f UTSW 15 75271803 missense probably damaging 1.00
R5295:Ly6f UTSW 15 75271639 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- GTCTGGGTAATACAGCCTGG -3'
(R):5'- TCTCATAATTCATCACTAGAGGGCTC -3'

Sequencing Primer
(F):5'- GCAGACTCTCAAAGAAGGA -3'
(R):5'- CATCACTAGAGGGCTCCAGGAAG -3'
Posted On2015-08-18