Mutagenetix > Incidental Mutation

Incidental Mutation 'R4550:Gm128'

333910

Institutional Source

Beutler Lab

Gene Symbol

Gm128

Ensembl Gene

ENSMUSG00000068860

Gene Name

predicted gene 128

Synonyms

Ment, LOC229588, Pmis1

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4550 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

95144231-95148909 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 95147472 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 274 (D274G)

Ref Sequence

ENSEMBL: ENSMUSP00000088324 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053872] [ENSMUST00000090815] [ENSMUST00000098871] [ENSMUST00000107195] [ENSMUST00000107197] [ENSMUST00000125515] [ENSMUST00000137250]

AlphaFold

Q569E4

Predicted Effect

probably benign
Transcript: ENSMUST00000053872

Predicted Effect

possibly damaging
Transcript: ENSMUST00000090815
AA Change: D274G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000088324
Gene: ENSMUSG00000068860
AA Change: D274G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:PMSI1	23	345	3.1e-144	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000098871

SMART Domains

Protein: ENSMUSP00000096468
Gene: ENSMUSG00000028115

Domain	Start	End	E-Value	Type
low complexity region	2	31	N/A	INTRINSIC
Pfam:BNIP2	48	178	4.5e-38	PFAM
Pfam:CRAL_TRIO_2	162	273	7.7e-16	PFAM
Pfam:CRAL_TRIO	196	263	3.2e-10	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000107195

SMART Domains

Protein: ENSMUSP00000102813
Gene: ENSMUSG00000028115

Domain	Start	End	E-Value	Type
low complexity region	33	44	N/A	INTRINSIC
low complexity region	50	62	N/A	INTRINSIC
low complexity region	104	117	N/A	INTRINSIC
SEC14	193	348	7.89e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107197

SMART Domains

Protein: ENSMUSP00000102815
Gene: ENSMUSG00000068860

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:PMSI1	23	130	1.8e-32	PFAM
Pfam:PMSI1	121	184	1.2e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000125515

SMART Domains

Protein: ENSMUSP00000120545
Gene: ENSMUSG00000028115

Domain	Start	End	E-Value	Type
low complexity region	2	31	N/A	INTRINSIC
Pfam:BNIP2	48	178	3.7e-38	PFAM
Pfam:CRAL_TRIO_2	168	259	7.5e-15	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000137250

SMART Domains

Protein: ENSMUSP00000115197
Gene: ENSMUSG00000028115

Domain	Start	End	E-Value	Type
low complexity region	5	16	N/A	INTRINSIC
low complexity region	22	34	N/A	INTRINSIC
low complexity region	76	89	N/A	INTRINSIC
SEC14	165	320	7.89e-13	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a proto-oncogene whose promoter is methylated by DNA methyltransferase 3B (DNMT3B), which represses the proto-oncogene. However, a catalytically inactive isoform of DNMT3B is overexpressed in lymphomas, leading to hypomethylation of the proto-oncogene's promoter and derepression of the proto-oncogene. [provided by RefSeq, Sep 2016]
PHENOTYPE: A targeted mutation results in slightly decreased fertilization rates for males, although normal litter sizes are produced. Phenotypic analysis of mice homozygous for a gene trap allele indicates no notable phenotype in any parameter tested. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 13 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd53	T	C	6: 83,742,242 (GRCm39)	V153A	probably damaging	Het
Ext1	A	G	15: 52,965,182 (GRCm39)	S395P	probably damaging	Het
Fhdc1	T	C	3: 84,352,483 (GRCm39)	K914R	probably benign	Het
Kcnd3	C	T	3: 105,566,082 (GRCm39)	A421V	probably damaging	Het
Kmt2c	G	C	5: 25,505,172 (GRCm39)	R3379G	probably damaging	Het
Myh14	T	C	7: 44,283,857 (GRCm39)	S675G	probably damaging	Het
Pop1	T	C	15: 34,529,082 (GRCm39)	F704S	probably damaging	Het
Ryr1	T	C	7: 28,798,160 (GRCm39)	T961A	probably benign	Het
Serpina11	A	G	12: 103,949,154 (GRCm39)	F341S	probably damaging	Het
Snapc1	C	A	12: 74,017,053 (GRCm39)	D9E	probably damaging	Het
Syt8	G	T	7: 141,993,199 (GRCm39)	V35L	probably benign	Het
Tchh	A	G	3: 93,352,617 (GRCm39)	R686G	unknown	Het
Top2b	T	G	14: 16,409,189 (GRCm38)	I777M	probably damaging	Het

Other mutations in Gm128

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01583:Gm128	APN	3	95,148,094 (GRCm39)	missense	possibly damaging	0.60
IGL02499:Gm128	APN	3	95,147,992 (GRCm39)	missense	possibly damaging	0.86
R1033:Gm128	UTSW	3	95,147,322 (GRCm39)	missense	possibly damaging	0.51
R2051:Gm128	UTSW	3	95,148,051 (GRCm39)	missense	possibly damaging	0.92
R2240:Gm128	UTSW	3	95,148,243 (GRCm39)	missense	probably benign	0.00
R2347:Gm128	UTSW	3	95,148,241 (GRCm39)	missense	probably benign	0.02
R2513:Gm128	UTSW	3	95,147,293 (GRCm39)	missense	possibly damaging	0.95
R4163:Gm128	UTSW	3	95,147,802 (GRCm39)	missense	probably benign	0.06
R6912:Gm128	UTSW	3	95,147,740 (GRCm39)	missense	probably benign	0.32
R7359:Gm128	UTSW	3	95,147,934 (GRCm39)	missense	probably benign	0.11
R7418:Gm128	UTSW	3	95,147,878 (GRCm39)	missense	possibly damaging	0.71

Predicted Primers

PCR Primer
(F):5'- AAAGGCTGTTCCAGATATCCTCC -3'
(R):5'- TGCCATCTCCTGAGGATCTG -3'

Sequencing Primer
(F):5'- GTTCCAGATATCCTCCAGGCCAATC -3'
(R):5'- ATCTGCGGGTAGTACTGATGCC -3'

Posted On

2015-08-18