Incidental Mutation 'R4550:Ankrd53'
ID333914
Institutional Source Beutler Lab
Gene Symbol Ankrd53
Ensembl Gene ENSMUSG00000014747
Gene Nameankyrin repeat domain 53
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4550 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location83762644-83768326 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83765260 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 153 (V153A)
Ref Sequence ENSEMBL: ENSMUSP00000145973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014891] [ENSMUST00000014892] [ENSMUST00000206496]
Predicted Effect probably damaging
Transcript: ENSMUST00000014891
AA Change: V208A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000014891
Gene: ENSMUSG00000014747
AA Change: V208A

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
ANK 110 140 1.15e0 SMART
ANK 144 177 1.63e0 SMART
ANK 181 210 1.78e-6 SMART
Blast:ANK 215 243 6e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000014892
SMART Domains Protein: ENSMUSP00000014892
Gene: ENSMUSG00000014748

DomainStartEndE-ValueType
Pfam:Erv26 1 186 6.2e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190077
Predicted Effect probably damaging
Transcript: ENSMUST00000206496
AA Change: V153A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 13 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ext1 A G 15: 53,101,786 S395P probably damaging Het
Fhdc1 T C 3: 84,445,176 K914R probably benign Het
Gm128 T C 3: 95,240,161 D274G possibly damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kmt2c G C 5: 25,300,174 R3379G probably damaging Het
Myh14 T C 7: 44,634,433 S675G probably damaging Het
Pop1 T C 15: 34,528,936 F704S probably damaging Het
Ryr1 T C 7: 29,098,735 T961A probably benign Het
Serpina11 A G 12: 103,982,895 F341S probably damaging Het
Snapc1 C A 12: 73,970,279 D9E probably damaging Het
Syt8 G T 7: 142,439,462 V35L probably benign Het
Tchh A G 3: 93,445,310 R686G unknown Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Other mutations in Ankrd53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01875:Ankrd53 APN 6 83763049 nonsense probably null
IGL03186:Ankrd53 APN 6 83763713 missense probably benign 0.15
PIT4651001:Ankrd53 UTSW 6 83765733 missense probably damaging 1.00
R0420:Ankrd53 UTSW 6 83763692 missense probably damaging 1.00
R0662:Ankrd53 UTSW 6 83763643 missense probably damaging 1.00
R1978:Ankrd53 UTSW 6 83763203 missense probably damaging 1.00
R2313:Ankrd53 UTSW 6 83763680 missense probably damaging 1.00
R2483:Ankrd53 UTSW 6 83763262 missense possibly damaging 0.52
R3623:Ankrd53 UTSW 6 83763262 missense possibly damaging 0.52
R3624:Ankrd53 UTSW 6 83763262 missense possibly damaging 0.52
R4836:Ankrd53 UTSW 6 83768152 missense probably damaging 1.00
R6144:Ankrd53 UTSW 6 83762657 unclassified probably benign
R6875:Ankrd53 UTSW 6 83768173 missense probably damaging 1.00
R7143:Ankrd53 UTSW 6 83762911 missense possibly damaging 0.93
R7293:Ankrd53 UTSW 6 83763196 missense probably null 1.00
Z1177:Ankrd53 UTSW 6 83765783 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGGGTATGAACAGGGTCCTC -3'
(R):5'- ACTTTACTCAACTGACACCTGC -3'

Sequencing Primer
(F):5'- ATGAACAGGGTCCTCCATGGTG -3'
(R):5'- AACTGACACCTGCCTTCTTCAAG -3'
Posted On2015-08-18