Mutagenetix > Incidental Mutations

Incidental Mutation 'R4550:Snapc1'

333920

Institutional Source

Beutler Lab

Gene Symbol

Snapc1

Ensembl Gene

ENSMUSG00000021113

Gene Name

small nuclear RNA activating complex, polypeptide 1

Synonyms

2700033G17Rik

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4550 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

73964481-73988966 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 73970279 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 9 (D9E)

Ref Sequence

ENSEMBL: ENSMUSP00000152248 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021532] [ENSMUST00000220882] [ENSMUST00000221556] [ENSMUST00000222025]

AlphaFold

Q8K0S9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000021532
AA Change: D230E

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000021532
Gene: ENSMUSG00000021113
AA Change: D230E

Domain	Start	End	E-Value	Type
low complexity region	2	16	N/A	INTRINSIC
Pfam:SNAPc_SNAP43	26	210	4.5e-65	PFAM
low complexity region	261	273	N/A	INTRINSIC
low complexity region	307	316	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000220882
AA Change: D9E

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

Predicted Effect

probably benign
Transcript: ENSMUST00000220909

Predicted Effect

probably benign
Transcript: ENSMUST00000221556

Predicted Effect

probably benign
Transcript: ENSMUST00000221833

Predicted Effect

probably benign
Transcript: ENSMUST00000222025

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 13 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd53	T	C	6: 83,765,260	V153A	probably damaging	Het
Ext1	A	G	15: 53,101,786	S395P	probably damaging	Het
Fhdc1	T	C	3: 84,445,176	K914R	probably benign	Het
Gm128	T	C	3: 95,240,161	D274G	possibly damaging	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Kmt2c	G	C	5: 25,300,174	R3379G	probably damaging	Het
Myh14	T	C	7: 44,634,433	S675G	probably damaging	Het
Pop1	T	C	15: 34,528,936	F704S	probably damaging	Het
Ryr1	T	C	7: 29,098,735	T961A	probably benign	Het
Serpina11	A	G	12: 103,982,895	F341S	probably damaging	Het
Syt8	G	T	7: 142,439,462	V35L	probably benign	Het
Tchh	A	G	3: 93,445,310	R686G	unknown	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het

Other mutations in Snapc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00272:Snapc1	APN	12	73968374	splice site	probably null
IGL00529:Snapc1	APN	12	73964655	missense	probably benign	0.00
IGL00676:Snapc1	APN	12	73971913	missense	probably damaging	1.00
IGL01373:Snapc1	APN	12	73964680	missense	probably benign	0.00
IGL02060:Snapc1	APN	12	73968036	missense	probably damaging	1.00
IGL02309:Snapc1	APN	12	73968027	missense	probably damaging	1.00
IGL02653:Snapc1	APN	12	73982487	missense	probably benign	0.00
IGL02686:Snapc1	APN	12	73964596	intron	probably benign
IGL03160:Snapc1	APN	12	73970204	missense	probably damaging	1.00
PIT4362001:Snapc1	UTSW	12	73982495	missense	probably damaging	0.98
R0056:Snapc1	UTSW	12	73975032	missense	probably damaging	1.00
R0057:Snapc1	UTSW	12	73975032	missense	probably damaging	1.00
R0057:Snapc1	UTSW	12	73975032	missense	probably damaging	1.00
R0113:Snapc1	UTSW	12	73975032	missense	probably damaging	1.00
R0152:Snapc1	UTSW	12	73975032	missense	probably damaging	1.00
R0153:Snapc1	UTSW	12	73975032	missense	probably damaging	1.00
R0244:Snapc1	UTSW	12	73975032	missense	probably damaging	1.00
R0245:Snapc1	UTSW	12	73975032	missense	probably damaging	1.00
R0316:Snapc1	UTSW	12	73975032	missense	probably damaging	1.00
R0318:Snapc1	UTSW	12	73975032	missense	probably damaging	1.00
R0352:Snapc1	UTSW	12	73975032	missense	probably damaging	1.00
R0646:Snapc1	UTSW	12	73975032	missense	probably damaging	1.00
R0841:Snapc1	UTSW	12	73975006	splice site	probably benign
R2188:Snapc1	UTSW	12	73970227	missense	probably damaging	1.00
R2483:Snapc1	UTSW	12	73964643	missense	probably benign	0.02
R4165:Snapc1	UTSW	12	73982580	critical splice donor site	probably null
R4169:Snapc1	UTSW	12	73982491	missense	probably benign	0.00
R4549:Snapc1	UTSW	12	73970279	missense	probably damaging	0.97
R4658:Snapc1	UTSW	12	73983868	missense	possibly damaging	0.75
R6976:Snapc1	UTSW	12	73970200	missense	probably damaging	1.00
R7432:Snapc1	UTSW	12	73968294	missense	probably benign	0.01
R7488:Snapc1	UTSW	12	73982511	missense	probably benign	0.39
R8507:Snapc1	UTSW	12	73964732	missense	probably damaging	1.00
R8809:Snapc1	UTSW	12	73975038	missense	probably benign	0.31

Predicted Primers

PCR Primer
(F):5'- GGTCTACACTTCCAACCAGC -3'
(R):5'- GGTAACGCCCTCTGAATCTTG -3'

Sequencing Primer
(F):5'- TGGGCCACATACGAAGACACTG -3'
(R):5'- CTGAATCTTGACTCCACAGCAATGTG -3'

Posted On

2015-08-18