Incidental Mutation 'R4551:Kif26b'
ID333935
Institutional Source Beutler Lab
Gene Symbol Kif26b
Ensembl Gene ENSMUSG00000026494
Gene Namekinesin family member 26B
SynonymsD230039L06Rik, N-11 kinesin
MMRRC Submission 041782-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4551 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location178529125-178939200 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 178884035 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 740 (I740N)
Ref Sequence ENSEMBL: ENSMUSP00000124462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160789] [ENSMUST00000161017]
Predicted Effect probably damaging
Transcript: ENSMUST00000160789
AA Change: I293N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124608
Gene: ENSMUSG00000026494
AA Change: I293N

DomainStartEndE-ValueType
KISc 1 362 2.48e-42 SMART
low complexity region 363 375 N/A INTRINSIC
low complexity region 402 416 N/A INTRINSIC
low complexity region 460 466 N/A INTRINSIC
low complexity region 560 600 N/A INTRINSIC
low complexity region 652 662 N/A INTRINSIC
low complexity region 822 841 N/A INTRINSIC
low complexity region 1038 1048 N/A INTRINSIC
low complexity region 1294 1322 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161017
AA Change: I740N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124462
Gene: ENSMUSG00000026494
AA Change: I740N

DomainStartEndE-ValueType
low complexity region 58 123 N/A INTRINSIC
low complexity region 144 155 N/A INTRINSIC
low complexity region 220 228 N/A INTRINSIC
Blast:KISc 365 446 4e-8 BLAST
KISc 448 809 2.48e-42 SMART
low complexity region 810 822 N/A INTRINSIC
low complexity region 849 863 N/A INTRINSIC
low complexity region 907 913 N/A INTRINSIC
low complexity region 1007 1047 N/A INTRINSIC
low complexity region 1099 1109 N/A INTRINSIC
low complexity region 1269 1288 N/A INTRINSIC
low complexity region 1485 1495 N/A INTRINSIC
low complexity region 1741 1769 N/A INTRINSIC
Meta Mutation Damage Score 0.5169 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (71/71)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality with impaired kidney development due to loss of cortical nephrogenic zone mesenchyme and failure of ureteric buds to invade and branch into the mesenchyme. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk T G 11: 120,011,569 E610A probably benign Het
Abhd17b T C 19: 21,680,926 S176P possibly damaging Het
Adgrg7 A G 16: 56,748,012 Y427H probably damaging Het
Alox15 T A 11: 70,344,596 I647L probably benign Het
Ankhd1 C A 18: 36,655,507 probably null Het
Arid1a A C 4: 133,695,699 probably benign Het
Armcx5 T A X: 135,746,507 V444D probably damaging Het
C4bp A G 1: 130,636,727 Y407H possibly damaging Het
Cog6 T A 3: 52,998,320 E96V probably damaging Het
Cox20 A C 1: 178,322,549 N96T probably benign Het
Cpa3 T C 3: 20,219,770 I351V probably benign Het
Cpd C T 11: 76,811,886 G552D probably damaging Het
Cyld A G 8: 88,707,134 K184E possibly damaging Het
Dab2 G A 15: 6,435,294 G324D probably damaging Het
Depdc1a T A 3: 159,522,584 D324E probably damaging Het
Dnah9 T C 11: 65,841,366 E4238G probably damaging Het
Dync1i1 T A 6: 5,923,206 D275E probably benign Het
Epgn A T 5: 91,027,562 K14* probably null Het
Farp2 T A 1: 93,618,592 L868Q possibly damaging Het
Gpr45 A G 1: 43,032,790 T198A probably benign Het
Grk2 C T 19: 4,286,056 V402M possibly damaging Het
Gsap A T 5: 21,290,571 D79V probably damaging Het
Gtf2h3 A G 5: 124,590,419 probably benign Het
Hus1b C A 13: 30,947,076 S200I probably damaging Het
Hypk A G 2: 121,453,480 probably null Het
Ikbke T C 1: 131,258,033 probably benign Het
Kat6b A G 14: 21,661,448 E670G probably damaging Het
Lhx3 G A 2: 26,201,190 P369L probably damaging Het
Man2c1 T C 9: 57,131,161 L35P probably damaging Het
Micalcl T A 7: 112,381,916 S366T possibly damaging Het
Mroh9 A T 1: 163,044,093 I607N probably damaging Het
Mybphl T C 3: 108,374,163 I65T possibly damaging Het
Myo1g A G 11: 6,517,874 I187T probably damaging Het
Myo7b T C 18: 31,985,108 S822G probably benign Het
Nkx2-4 C A 2: 147,084,922 A142S probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Odf4 C T 11: 68,922,040 S264N probably benign Het
Olfr360 G T 2: 37,068,343 V13L probably benign Het
Olfr45 A T 7: 140,691,742 Y279F probably damaging Het
Olfr657 A T 7: 104,636,424 H250L probably damaging Het
Papolb T C 5: 142,529,178 I237V probably benign Het
Parpbp T A 10: 88,093,702 Q428L possibly damaging Het
Pcdhb16 T C 18: 37,479,834 F616L probably damaging Het
Pdk3 A T X: 93,782,240 M253K probably damaging Het
Pgap2 C A 7: 102,226,467 probably benign Het
Pkhd1l1 C A 15: 44,550,885 N2849K probably damaging Het
Pprc1 A G 19: 46,067,225 probably benign Het
Psma2 A G 13: 14,616,845 Y25C possibly damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptpn5 C A 7: 47,090,852 probably benign Het
Pxn G T 5: 115,552,720 probably benign Het
Scd3 C A 19: 44,215,439 A22E probably benign Het
Sdr42e1 T C 8: 117,663,608 E98G probably benign Het
Slc14a2 A C 18: 78,195,853 S184A probably benign Het
Tmem236 A T 2: 14,219,153 Q251L probably benign Het
Trappc8 T C 18: 20,874,672 T129A probably benign Het
Vmn1r90 A C 7: 14,561,969 M68R possibly damaging Het
Vmn2r105 A G 17: 20,226,351 V462A probably benign Het
Vmn2r7 T C 3: 64,690,689 T816A possibly damaging Het
Vmn2r81 T A 10: 79,268,407 I288K possibly damaging Het
Zfp180 A C 7: 24,104,573 K139T possibly damaging Het
Zfp932 T C 5: 110,009,639 V401A probably benign Het
Other mutations in Kif26b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Kif26b APN 1 178915648 missense probably damaging 1.00
IGL00425:Kif26b APN 1 178916301 missense probably damaging 0.96
IGL00952:Kif26b APN 1 178932205 missense probably damaging 1.00
IGL01100:Kif26b APN 1 178917244 missense probably benign
IGL01347:Kif26b APN 1 178870675 missense probably damaging 1.00
IGL01543:Kif26b APN 1 178678961 missense probably benign 0.41
IGL01938:Kif26b APN 1 178916038 missense probably damaging 0.99
IGL02100:Kif26b APN 1 178915947 missense probably damaging 0.99
IGL02262:Kif26b APN 1 178916068 missense probably benign 0.05
IGL02576:Kif26b APN 1 178916347 missense probably benign
IGL02673:Kif26b APN 1 178821605 missense probably damaging 1.00
IGL03078:Kif26b APN 1 178870726 missense probably damaging 1.00
IGL03155:Kif26b APN 1 178874128 missense probably damaging 1.00
IGL03157:Kif26b APN 1 178916365 missense probably damaging 1.00
IGL03162:Kif26b APN 1 178916932 missense probably benign
IGL03220:Kif26b APN 1 178864869 missense probably damaging 1.00
IGL03299:Kif26b APN 1 178821560 missense probably benign 0.09
IGL03368:Kif26b APN 1 178916208 missense probably damaging 1.00
IGL03370:Kif26b APN 1 178915381 missense probably benign 0.39
PIT4449001:Kif26b UTSW 1 178918086 missense probably damaging 1.00
R0142:Kif26b UTSW 1 178915389 missense probably damaging 1.00
R0621:Kif26b UTSW 1 178915653 missense probably benign 0.02
R0987:Kif26b UTSW 1 178821620 missense probably damaging 1.00
R1107:Kif26b UTSW 1 178917673 missense probably benign 0.03
R1367:Kif26b UTSW 1 178916463 missense probably damaging 1.00
R1386:Kif26b UTSW 1 178915644 missense probably benign
R1619:Kif26b UTSW 1 178916478 missense probably benign 0.00
R1664:Kif26b UTSW 1 178932139 missense probably damaging 1.00
R2240:Kif26b UTSW 1 178715923 missense probably benign 0.00
R2264:Kif26b UTSW 1 178928842 critical splice acceptor site probably null
R2443:Kif26b UTSW 1 178915014 missense probably damaging 0.99
R3023:Kif26b UTSW 1 178864868 missense probably damaging 0.99
R3744:Kif26b UTSW 1 178679030 missense probably benign 0.00
R3831:Kif26b UTSW 1 178916616 frame shift probably null
R3832:Kif26b UTSW 1 178916616 frame shift probably null
R3833:Kif26b UTSW 1 178916616 frame shift probably null
R3843:Kif26b UTSW 1 178928177 missense probably damaging 1.00
R4108:Kif26b UTSW 1 178916965 missense possibly damaging 0.88
R4181:Kif26b UTSW 1 178915426 missense probably damaging 0.98
R4552:Kif26b UTSW 1 178884035 missense probably damaging 1.00
R4597:Kif26b UTSW 1 178916793 missense probably damaging 1.00
R4599:Kif26b UTSW 1 178530459 missense unknown
R4610:Kif26b UTSW 1 178679355 missense probably damaging 1.00
R4746:Kif26b UTSW 1 178873981 nonsense probably null
R4873:Kif26b UTSW 1 178915327 missense probably benign 0.38
R4875:Kif26b UTSW 1 178915327 missense probably benign 0.38
R5015:Kif26b UTSW 1 178928330 missense probably damaging 0.99
R5060:Kif26b UTSW 1 178530630 missense unknown
R5301:Kif26b UTSW 1 178530668 missense unknown
R5368:Kif26b UTSW 1 178915884 missense probably damaging 1.00
R5387:Kif26b UTSW 1 178914876 missense probably benign 0.01
R5589:Kif26b UTSW 1 178916299 missense probably benign 0.05
R6150:Kif26b UTSW 1 178915546 missense probably damaging 1.00
R6259:Kif26b UTSW 1 178917405 missense probably damaging 0.97
R6355:Kif26b UTSW 1 178916178 missense probably damaging 1.00
R6408:Kif26b UTSW 1 178917568 missense probably damaging 1.00
R6488:Kif26b UTSW 1 178529573 missense unknown
R6546:Kif26b UTSW 1 178928306 missense probably damaging 1.00
R6702:Kif26b UTSW 1 178917287 missense possibly damaging 0.90
R6886:Kif26b UTSW 1 178874138 missense probably damaging 1.00
R6953:Kif26b UTSW 1 178874072 missense possibly damaging 0.89
R7262:Kif26b UTSW 1 178917654 missense possibly damaging 0.84
R7291:Kif26b UTSW 1 178679046 missense possibly damaging 0.86
R7346:Kif26b UTSW 1 178530741 missense probably damaging 1.00
R7383:Kif26b UTSW 1 178530710 missense probably damaging 1.00
R7448:Kif26b UTSW 1 178914774 missense probably damaging 1.00
R7506:Kif26b UTSW 1 178529499 start gained probably benign
R7562:Kif26b UTSW 1 178914976 missense probably damaging 1.00
R7583:Kif26b UTSW 1 178530445 nonsense probably null
R7585:Kif26b UTSW 1 178916496 missense probably benign 0.01
R7644:Kif26b UTSW 1 178679274 missense probably benign 0.04
R7759:Kif26b UTSW 1 178678944 missense probably damaging 1.00
R7775:Kif26b UTSW 1 178864876 missense probably benign 0.15
R7954:Kif26b UTSW 1 178869379 missense probably damaging 0.99
R7960:Kif26b UTSW 1 178678919 missense probably damaging 1.00
R8012:Kif26b UTSW 1 178916250 missense probably benign 0.20
R8152:Kif26b UTSW 1 178679229 missense possibly damaging 0.46
R8320:Kif26b UTSW 1 178884076 critical splice donor site probably null
R8360:Kif26b UTSW 1 178916373 missense probably benign 0.18
R8428:Kif26b UTSW 1 178917358 missense probably benign 0.09
R8670:Kif26b UTSW 1 178913784 missense probably damaging 1.00
R8737:Kif26b UTSW 1 178864865 missense probably damaging 0.99
R8788:Kif26b UTSW 1 178529525 start gained probably benign
R8854:Kif26b UTSW 1 178916383 missense possibly damaging 0.93
R8870:Kif26b UTSW 1 178865029 missense probably damaging 1.00
X0021:Kif26b UTSW 1 178928159 missense probably damaging 1.00
X0024:Kif26b UTSW 1 178679082 missense probably benign 0.14
X0025:Kif26b UTSW 1 178915266 nonsense probably null
X0025:Kif26b UTSW 1 178915383 missense possibly damaging 0.70
Z1177:Kif26b UTSW 1 178821548 missense probably benign 0.11
Z1177:Kif26b UTSW 1 178821550 nonsense probably null
Z1177:Kif26b UTSW 1 178915405 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAATGTGTTGCCCAGACCTTAC -3'
(R):5'- CCTCCGTGACATAGCTTTTGG -3'

Sequencing Primer
(F):5'- GTTGCCCAGACCTTACCCACTC -3'
(R):5'- GCTAAAGCTAATCTCTGTCACTG -3'
Posted On2015-08-18