Incidental Mutation 'R4551:Olfr360'
ID333937
Institutional Source Beutler Lab
Gene Symbol Olfr360
Ensembl Gene ENSMUSG00000083361
Gene Nameolfactory receptor 360
SynonymsMOR159-1, GA_x6K02T2NLDC-33760081-33761034
MMRRC Submission 041782-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R4551 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location37065746-37069651 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 37068343 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 13 (V13L)
Ref Sequence ENSEMBL: ENSMUSP00000149581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120704] [ENSMUST00000216706]
Predicted Effect probably benign
Transcript: ENSMUST00000120505
AA Change: V13L

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000112456
Gene: ENSMUSG00000083361
AA Change: V13L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 206 6e-7 PFAM
Pfam:7tm_1 41 289 1.1e-25 PFAM
Pfam:7tm_4 139 282 6.6e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120704
AA Change: V13L

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000114121
Gene: ENSMUSG00000083361
AA Change: V13L

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2e-45 PFAM
Pfam:7TM_GPCR_Srsx 35 206 6e-7 PFAM
Pfam:7tm_1 41 289 5.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216706
AA Change: V13L

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk T G 11: 120,011,569 E610A probably benign Het
Abhd17b T C 19: 21,680,926 S176P possibly damaging Het
Adgrg7 A G 16: 56,748,012 Y427H probably damaging Het
Alox15 T A 11: 70,344,596 I647L probably benign Het
Ankhd1 C A 18: 36,655,507 probably null Het
Arid1a A C 4: 133,695,699 probably benign Het
Armcx5 T A X: 135,746,507 V444D probably damaging Het
C4bp A G 1: 130,636,727 Y407H possibly damaging Het
Cog6 T A 3: 52,998,320 E96V probably damaging Het
Cox20 A C 1: 178,322,549 N96T probably benign Het
Cpa3 T C 3: 20,219,770 I351V probably benign Het
Cpd C T 11: 76,811,886 G552D probably damaging Het
Cyld A G 8: 88,707,134 K184E possibly damaging Het
Dab2 G A 15: 6,435,294 G324D probably damaging Het
Depdc1a T A 3: 159,522,584 D324E probably damaging Het
Dnah9 T C 11: 65,841,366 E4238G probably damaging Het
Dync1i1 T A 6: 5,923,206 D275E probably benign Het
Epgn A T 5: 91,027,562 K14* probably null Het
Farp2 T A 1: 93,618,592 L868Q possibly damaging Het
Gpr45 A G 1: 43,032,790 T198A probably benign Het
Grk2 C T 19: 4,286,056 V402M possibly damaging Het
Gsap A T 5: 21,290,571 D79V probably damaging Het
Gtf2h3 A G 5: 124,590,419 probably benign Het
Hus1b C A 13: 30,947,076 S200I probably damaging Het
Hypk A G 2: 121,453,480 probably null Het
Ikbke T C 1: 131,258,033 probably benign Het
Kat6b A G 14: 21,661,448 E670G probably damaging Het
Kif26b T A 1: 178,884,035 I740N probably damaging Het
Lhx3 G A 2: 26,201,190 P369L probably damaging Het
Man2c1 T C 9: 57,131,161 L35P probably damaging Het
Micalcl T A 7: 112,381,916 S366T possibly damaging Het
Mroh9 A T 1: 163,044,093 I607N probably damaging Het
Mybphl T C 3: 108,374,163 I65T possibly damaging Het
Myo1g A G 11: 6,517,874 I187T probably damaging Het
Myo7b T C 18: 31,985,108 S822G probably benign Het
Nkx2-4 C A 2: 147,084,922 A142S probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Odf4 C T 11: 68,922,040 S264N probably benign Het
Olfr45 A T 7: 140,691,742 Y279F probably damaging Het
Olfr657 A T 7: 104,636,424 H250L probably damaging Het
Papolb T C 5: 142,529,178 I237V probably benign Het
Parpbp T A 10: 88,093,702 Q428L possibly damaging Het
Pcdhb16 T C 18: 37,479,834 F616L probably damaging Het
Pdk3 A T X: 93,782,240 M253K probably damaging Het
Pgap2 C A 7: 102,226,467 probably benign Het
Pkhd1l1 C A 15: 44,550,885 N2849K probably damaging Het
Pprc1 A G 19: 46,067,225 probably benign Het
Psma2 A G 13: 14,616,845 Y25C possibly damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptpn5 C A 7: 47,090,852 probably benign Het
Pxn G T 5: 115,552,720 probably benign Het
Scd3 C A 19: 44,215,439 A22E probably benign Het
Sdr42e1 T C 8: 117,663,608 E98G probably benign Het
Slc14a2 A C 18: 78,195,853 S184A probably benign Het
Tmem236 A T 2: 14,219,153 Q251L probably benign Het
Trappc8 T C 18: 20,874,672 T129A probably benign Het
Vmn1r90 A C 7: 14,561,969 M68R possibly damaging Het
Vmn2r105 A G 17: 20,226,351 V462A probably benign Het
Vmn2r7 T C 3: 64,690,689 T816A possibly damaging Het
Vmn2r81 T A 10: 79,268,407 I288K possibly damaging Het
Zfp180 A C 7: 24,104,573 K139T possibly damaging Het
Zfp932 T C 5: 110,009,639 V401A probably benign Het
Other mutations in Olfr360
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02394:Olfr360 APN 2 37068485 missense probably damaging 1.00
H8786:Olfr360 UTSW 2 37068329 missense probably benign 0.41
R4896:Olfr360 UTSW 2 37068410 missense probably damaging 1.00
R5004:Olfr360 UTSW 2 37068410 missense probably damaging 1.00
R5828:Olfr360 UTSW 2 37068989 missense probably benign 0.00
R6173:Olfr360 UTSW 2 37069079 missense possibly damaging 0.78
R6802:Olfr360 UTSW 2 37068415 missense probably benign
R6859:Olfr360 UTSW 2 37068782 missense probably damaging 0.98
R7171:Olfr360 UTSW 2 37068388 missense possibly damaging 0.91
R7712:Olfr360 UTSW 2 37068904 missense probably damaging 1.00
R7798:Olfr360 UTSW 2 37069174 missense probably damaging 1.00
T0722:Olfr360 UTSW 2 37068437 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTAGGGACAGAATACTGCTC -3'
(R):5'- TCCGATTTACAGAGAGTGTGTG -3'

Sequencing Primer
(F):5'- TTAGGGACAGAATACTGCTCCAATG -3'
(R):5'- CACTAGCATCTGAGGAATAGTGATG -3'
Posted On2015-08-18