Incidental Mutation 'R4551:Epgn'
ID333946
Institutional Source Beutler Lab
Gene Symbol Epgn
Ensembl Gene ENSMUSG00000035020
Gene Nameepithelial mitogen
Synonyms2310069M11Rik, epigen
MMRRC Submission 041782-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4551 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location91027464-91035215 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 91027562 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 14 (K14*)
Ref Sequence ENSEMBL: ENSMUSP00000046987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041516] [ENSMUST00000202724]
Predicted Effect probably null
Transcript: ENSMUST00000041516
AA Change: K14*
SMART Domains Protein: ENSMUSP00000046987
Gene: ENSMUSG00000035020
AA Change: K14*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EGF 58 95 1.01e-1 SMART
transmembrane domain 110 132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202724
SMART Domains Protein: ENSMUSP00000144500
Gene: ENSMUSG00000035020

DomainStartEndE-ValueType
EGF 43 80 5.1e-4 SMART
transmembrane domain 95 117 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the epidermal growth factor family. Members of this family are ligands for the epidermal growth factor receptor and play a role in cell survival, proliferation and migration. This protein has been reported to have high mitogenic activity but low affinity for its receptor. Expression of this transcript and protein have been reported in cancer specimens of the breast, bladder, and prostate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit moderate increase in absolute pancreas and spleen weight but normal epidermis and pilosebaceous unit development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk T G 11: 120,011,569 E610A probably benign Het
Abhd17b T C 19: 21,680,926 S176P possibly damaging Het
Adgrg7 A G 16: 56,748,012 Y427H probably damaging Het
Alox15 T A 11: 70,344,596 I647L probably benign Het
Ankhd1 C A 18: 36,655,507 probably null Het
Arid1a A C 4: 133,695,699 probably benign Het
Armcx5 T A X: 135,746,507 V444D probably damaging Het
C4bp A G 1: 130,636,727 Y407H possibly damaging Het
Cog6 T A 3: 52,998,320 E96V probably damaging Het
Cox20 A C 1: 178,322,549 N96T probably benign Het
Cpa3 T C 3: 20,219,770 I351V probably benign Het
Cpd C T 11: 76,811,886 G552D probably damaging Het
Cyld A G 8: 88,707,134 K184E possibly damaging Het
Dab2 G A 15: 6,435,294 G324D probably damaging Het
Depdc1a T A 3: 159,522,584 D324E probably damaging Het
Dnah9 T C 11: 65,841,366 E4238G probably damaging Het
Dync1i1 T A 6: 5,923,206 D275E probably benign Het
Farp2 T A 1: 93,618,592 L868Q possibly damaging Het
Gpr45 A G 1: 43,032,790 T198A probably benign Het
Grk2 C T 19: 4,286,056 V402M possibly damaging Het
Gsap A T 5: 21,290,571 D79V probably damaging Het
Gtf2h3 A G 5: 124,590,419 probably benign Het
Hus1b C A 13: 30,947,076 S200I probably damaging Het
Hypk A G 2: 121,453,480 probably null Het
Ikbke T C 1: 131,258,033 probably benign Het
Kat6b A G 14: 21,661,448 E670G probably damaging Het
Kif26b T A 1: 178,884,035 I740N probably damaging Het
Lhx3 G A 2: 26,201,190 P369L probably damaging Het
Man2c1 T C 9: 57,131,161 L35P probably damaging Het
Micalcl T A 7: 112,381,916 S366T possibly damaging Het
Mroh9 A T 1: 163,044,093 I607N probably damaging Het
Mybphl T C 3: 108,374,163 I65T possibly damaging Het
Myo1g A G 11: 6,517,874 I187T probably damaging Het
Myo7b T C 18: 31,985,108 S822G probably benign Het
Nkx2-4 C A 2: 147,084,922 A142S probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Odf4 C T 11: 68,922,040 S264N probably benign Het
Olfr360 G T 2: 37,068,343 V13L probably benign Het
Olfr45 A T 7: 140,691,742 Y279F probably damaging Het
Olfr657 A T 7: 104,636,424 H250L probably damaging Het
Papolb T C 5: 142,529,178 I237V probably benign Het
Parpbp T A 10: 88,093,702 Q428L possibly damaging Het
Pcdhb16 T C 18: 37,479,834 F616L probably damaging Het
Pdk3 A T X: 93,782,240 M253K probably damaging Het
Pgap2 C A 7: 102,226,467 probably benign Het
Pkhd1l1 C A 15: 44,550,885 N2849K probably damaging Het
Pprc1 A G 19: 46,067,225 probably benign Het
Psma2 A G 13: 14,616,845 Y25C possibly damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptpn5 C A 7: 47,090,852 probably benign Het
Pxn G T 5: 115,552,720 probably benign Het
Scd3 C A 19: 44,215,439 A22E probably benign Het
Sdr42e1 T C 8: 117,663,608 E98G probably benign Het
Slc14a2 A C 18: 78,195,853 S184A probably benign Het
Tmem236 A T 2: 14,219,153 Q251L probably benign Het
Trappc8 T C 18: 20,874,672 T129A probably benign Het
Vmn1r90 A C 7: 14,561,969 M68R possibly damaging Het
Vmn2r105 A G 17: 20,226,351 V462A probably benign Het
Vmn2r7 T C 3: 64,690,689 T816A possibly damaging Het
Vmn2r81 T A 10: 79,268,407 I288K possibly damaging Het
Zfp180 A C 7: 24,104,573 K139T possibly damaging Het
Zfp932 T C 5: 110,009,639 V401A probably benign Het
Other mutations in Epgn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02090:Epgn APN 5 91033957 missense probably damaging 0.99
R0309:Epgn UTSW 5 91032214 missense probably benign 0.06
R0478:Epgn UTSW 5 91031128 missense probably benign 0.00
R1034:Epgn UTSW 5 91032221 missense probably damaging 1.00
R4552:Epgn UTSW 5 91027562 nonsense probably null
R4553:Epgn UTSW 5 91027562 nonsense probably null
R4997:Epgn UTSW 5 91032239 missense possibly damaging 0.58
R5177:Epgn UTSW 5 91028277 start gained probably benign
R5754:Epgn UTSW 5 91033948 missense probably benign 0.09
R5881:Epgn UTSW 5 91028363 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TTGGATTGGTAAGAACAGCCAG -3'
(R):5'- ACACTTCAGGCTTCTTTGAGAGAG -3'

Sequencing Primer
(F):5'- GAACAGCCAGATGACGCTTCG -3'
(R):5'- TCAGGCTTCTTTGAGAGAGAGAAAAG -3'
Posted On2015-08-18