Incidental Mutation 'R4551:Pxn'
ID333948
Institutional Source Beutler Lab
Gene Symbol Pxn
Ensembl Gene ENSMUSG00000029528
Gene Namepaxillin
SynonymsPax
MMRRC Submission 041782-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4551 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location115506676-115555987 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to T at 115552720 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067268] [ENSMUST00000086523] [ENSMUST00000202564] [ENSMUST00000212819]
Predicted Effect probably benign
Transcript: ENSMUST00000067268
SMART Domains Protein: ENSMUSP00000069624
Gene: ENSMUSG00000029528

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:Paxillin 44 253 1.6e-98 PFAM
low complexity region 281 300 N/A INTRINSIC
LIM 323 374 3.99e-23 SMART
LIM 382 433 2.36e-16 SMART
LIM 441 492 8.16e-20 SMART
LIM 500 551 8.62e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086523
SMART Domains Protein: ENSMUSP00000083709
Gene: ENSMUSG00000029528

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:Paxillin 44 253 4.8e-97 PFAM
low complexity region 315 334 N/A INTRINSIC
LIM 357 408 3.99e-23 SMART
LIM 416 467 2.36e-16 SMART
LIM 475 526 8.16e-20 SMART
LIM 534 585 8.62e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125007
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152156
Predicted Effect probably benign
Transcript: ENSMUST00000202564
SMART Domains Protein: ENSMUSP00000144459
Gene: ENSMUSG00000029528

DomainStartEndE-ValueType
Pfam:Paxillin 1 120 5.8e-59 PFAM
low complexity region 148 167 N/A INTRINSIC
LIM 190 241 1.9e-25 SMART
LIM 249 300 1.1e-18 SMART
LIM 308 359 4e-22 SMART
LIM 367 418 4.4e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212819
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein involved in actin-membrane attachment at sites of cell adhesion to the extracellular matrix (focal adhesion). Alternatively spliced transcript variants encoding different isoforms have been described for this gene. These isoforms exhibit different expression pattern, and have different biochemical, as well as physiological properties (PMID:9054445). [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous mutant mice die at E9.5 with defects in the amnion, allantois, and headfold structures, as well as impaired growth, and abnormal heart and somite development; mutant fibroblasts show aberrant fibronectin-regulated focal adhesion dynamics, and disorganized membrane cytoskeletal structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk T G 11: 120,011,569 E610A probably benign Het
Abhd17b T C 19: 21,680,926 S176P possibly damaging Het
Adgrg7 A G 16: 56,748,012 Y427H probably damaging Het
Alox15 T A 11: 70,344,596 I647L probably benign Het
Ankhd1 C A 18: 36,655,507 probably null Het
Arid1a A C 4: 133,695,699 probably benign Het
Armcx5 T A X: 135,746,507 V444D probably damaging Het
C4bp A G 1: 130,636,727 Y407H possibly damaging Het
Cog6 T A 3: 52,998,320 E96V probably damaging Het
Cox20 A C 1: 178,322,549 N96T probably benign Het
Cpa3 T C 3: 20,219,770 I351V probably benign Het
Cpd C T 11: 76,811,886 G552D probably damaging Het
Cyld A G 8: 88,707,134 K184E possibly damaging Het
Dab2 G A 15: 6,435,294 G324D probably damaging Het
Depdc1a T A 3: 159,522,584 D324E probably damaging Het
Dnah9 T C 11: 65,841,366 E4238G probably damaging Het
Dync1i1 T A 6: 5,923,206 D275E probably benign Het
Epgn A T 5: 91,027,562 K14* probably null Het
Farp2 T A 1: 93,618,592 L868Q possibly damaging Het
Gpr45 A G 1: 43,032,790 T198A probably benign Het
Grk2 C T 19: 4,286,056 V402M possibly damaging Het
Gsap A T 5: 21,290,571 D79V probably damaging Het
Gtf2h3 A G 5: 124,590,419 probably benign Het
Hus1b C A 13: 30,947,076 S200I probably damaging Het
Hypk A G 2: 121,453,480 probably null Het
Ikbke T C 1: 131,258,033 probably benign Het
Kat6b A G 14: 21,661,448 E670G probably damaging Het
Kif26b T A 1: 178,884,035 I740N probably damaging Het
Lhx3 G A 2: 26,201,190 P369L probably damaging Het
Man2c1 T C 9: 57,131,161 L35P probably damaging Het
Micalcl T A 7: 112,381,916 S366T possibly damaging Het
Mroh9 A T 1: 163,044,093 I607N probably damaging Het
Mybphl T C 3: 108,374,163 I65T possibly damaging Het
Myo1g A G 11: 6,517,874 I187T probably damaging Het
Myo7b T C 18: 31,985,108 S822G probably benign Het
Nkx2-4 C A 2: 147,084,922 A142S probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Odf4 C T 11: 68,922,040 S264N probably benign Het
Olfr360 G T 2: 37,068,343 V13L probably benign Het
Olfr45 A T 7: 140,691,742 Y279F probably damaging Het
Olfr657 A T 7: 104,636,424 H250L probably damaging Het
Papolb T C 5: 142,529,178 I237V probably benign Het
Parpbp T A 10: 88,093,702 Q428L possibly damaging Het
Pcdhb16 T C 18: 37,479,834 F616L probably damaging Het
Pdk3 A T X: 93,782,240 M253K probably damaging Het
Pgap2 C A 7: 102,226,467 probably benign Het
Pkhd1l1 C A 15: 44,550,885 N2849K probably damaging Het
Pprc1 A G 19: 46,067,225 probably benign Het
Psma2 A G 13: 14,616,845 Y25C possibly damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptpn5 C A 7: 47,090,852 probably benign Het
Scd3 C A 19: 44,215,439 A22E probably benign Het
Sdr42e1 T C 8: 117,663,608 E98G probably benign Het
Slc14a2 A C 18: 78,195,853 S184A probably benign Het
Tmem236 A T 2: 14,219,153 Q251L probably benign Het
Trappc8 T C 18: 20,874,672 T129A probably benign Het
Vmn1r90 A C 7: 14,561,969 M68R possibly damaging Het
Vmn2r105 A G 17: 20,226,351 V462A probably benign Het
Vmn2r7 T C 3: 64,690,689 T816A possibly damaging Het
Vmn2r81 T A 10: 79,268,407 I288K possibly damaging Het
Zfp180 A C 7: 24,104,573 K139T possibly damaging Het
Zfp932 T C 5: 110,009,639 V401A probably benign Het
Other mutations in Pxn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02332:Pxn APN 5 115544926 missense probably benign 0.00
IGL02432:Pxn APN 5 115545746 missense probably damaging 1.00
IGL02454:Pxn APN 5 115552266 missense probably damaging 1.00
R0316:Pxn UTSW 5 115553968 missense probably damaging 1.00
R0778:Pxn UTSW 5 115552177 missense probably damaging 1.00
R1680:Pxn UTSW 5 115552147 missense probably damaging 1.00
R1874:Pxn UTSW 5 115544990 missense probably damaging 1.00
R2069:Pxn UTSW 5 115545667 missense probably benign 0.26
R2145:Pxn UTSW 5 115552756 unclassified probably benign
R4124:Pxn UTSW 5 115546907 missense probably damaging 1.00
R4126:Pxn UTSW 5 115546907 missense probably damaging 1.00
R4127:Pxn UTSW 5 115546907 missense probably damaging 1.00
R4717:Pxn UTSW 5 115551942 missense probably damaging 0.99
R5217:Pxn UTSW 5 115544915 missense probably benign 0.13
R5332:Pxn UTSW 5 115544369 missense probably damaging 1.00
R5635:Pxn UTSW 5 115551492 missense probably benign
R5681:Pxn UTSW 5 115544534 missense possibly damaging 0.94
R6629:Pxn UTSW 5 115554062 missense probably damaging 1.00
R6702:Pxn UTSW 5 115551896 missense probably benign 0.11
R7516:Pxn UTSW 5 115506863 missense unknown
R7671:Pxn UTSW 5 115548547 missense not run
X0018:Pxn UTSW 5 115545732 missense probably damaging 1.00
X0025:Pxn UTSW 5 115546895 missense probably damaging 0.97
X0065:Pxn UTSW 5 115551487 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGTGAACCCGTGAGTTTGAG -3'
(R):5'- ATTCAGAGGTAGACCCAGAGC -3'

Sequencing Primer
(F):5'- ACCCGTGAGTTTGAGCTCGAAG -3'
(R):5'- ATCGGCGAGGTCACCCTAC -3'
Posted On2015-08-18