Incidental Mutation 'R4551:Dnah9'
ID 333968
Institutional Source Beutler Lab
Gene Symbol Dnah9
Ensembl Gene ENSMUSG00000056752
Gene Name dynein, axonemal, heavy chain 9
Synonyms D11Ertd686e, Dnahc9
MMRRC Submission 041782-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.294) question?
Stock # R4551 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 65831282-66168551 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 65841366 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 4238 (E4238G)
Ref Sequence ENSEMBL: ENSMUSP00000079494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080665]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000080665
AA Change: E4238G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079494
Gene: ENSMUSG00000056752
AA Change: E4238G

DomainStartEndE-ValueType
Pfam:DHC_N1 209 787 3.6e-164 PFAM
coiled coil region 788 820 N/A INTRINSIC
low complexity region 1228 1240 N/A INTRINSIC
Pfam:DHC_N2 1290 1699 1.4e-134 PFAM
AAA 1863 1999 4.9e-1 SMART
AAA 2141 2341 1.99e0 SMART
AAA 2468 2614 6.75e-1 SMART
Pfam:AAA_8 2786 3053 1.1e-165 PFAM
Pfam:MT 3065 3408 7.2e-208 PFAM
Pfam:AAA_9 3430 3652 3.2e-87 PFAM
Pfam:Dynein_heavy 3786 4482 1e-241 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000152386
AA Change: E1711G
SMART Domains Protein: ENSMUSP00000116499
Gene: ENSMUSG00000056752
AA Change: E1711G

DomainStartEndE-ValueType
Pfam:AAA_7 1 258 3e-155 PFAM
Pfam:AAA_8 336 603 3.9e-166 PFAM
Pfam:MT 615 958 2.3e-208 PFAM
Pfam:AAA_9 980 1202 1.1e-87 PFAM
Pfam:Dynein_heavy 1336 1514 2.4e-52 PFAM
Pfam:Dynein_heavy 1508 1956 8.6e-155 PFAM
Meta Mutation Damage Score 0.2614 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the heavy chain subunit of axonemal dynein, a large multi-subunit molecular motor. Axonemal dynein attaches to microtubules and hydrolyzes ATP to mediate the movement of cilia and flagella. The gene expresses at least two transcript variants; additional variants have been described, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk T G 11: 120,011,569 (GRCm38) E610A probably benign Het
Abhd17b T C 19: 21,680,926 (GRCm38) S176P possibly damaging Het
Adgrg7 A G 16: 56,748,012 (GRCm38) Y427H probably damaging Het
Alox15 T A 11: 70,344,596 (GRCm38) I647L probably benign Het
Ankhd1 C A 18: 36,655,507 (GRCm38) probably null Het
Arid1a A C 4: 133,695,699 (GRCm38) probably benign Het
Armcx5 T A X: 135,746,507 (GRCm38) V444D probably damaging Het
C4bp A G 1: 130,636,727 (GRCm38) Y407H possibly damaging Het
Cog6 T A 3: 52,998,320 (GRCm38) E96V probably damaging Het
Cox20 A C 1: 178,322,549 (GRCm38) N96T probably benign Het
Cpa3 T C 3: 20,219,770 (GRCm38) I351V probably benign Het
Cpd C T 11: 76,811,886 (GRCm38) G552D probably damaging Het
Cyld A G 8: 88,707,134 (GRCm38) K184E possibly damaging Het
Dab2 G A 15: 6,435,294 (GRCm38) G324D probably damaging Het
Depdc1a T A 3: 159,522,584 (GRCm38) D324E probably damaging Het
Dync1i1 T A 6: 5,923,206 (GRCm38) D275E probably benign Het
Epgn A T 5: 91,027,562 (GRCm38) K14* probably null Het
Farp2 T A 1: 93,618,592 (GRCm38) L868Q possibly damaging Het
Gpr45 A G 1: 43,032,790 (GRCm38) T198A probably benign Het
Grk2 C T 19: 4,286,056 (GRCm38) V402M possibly damaging Het
Gsap A T 5: 21,290,571 (GRCm38) D79V probably damaging Het
Gtf2h3 A G 5: 124,590,419 (GRCm38) probably benign Het
Hus1b C A 13: 30,947,076 (GRCm38) S200I probably damaging Het
Hypk A G 2: 121,453,480 (GRCm38) probably null Het
Ikbke T C 1: 131,258,033 (GRCm38) probably benign Het
Kat6b A G 14: 21,661,448 (GRCm38) E670G probably damaging Het
Kif26b T A 1: 178,884,035 (GRCm38) I740N probably damaging Het
Lhx3 G A 2: 26,201,190 (GRCm38) P369L probably damaging Het
Man2c1 T C 9: 57,131,161 (GRCm38) L35P probably damaging Het
Micalcl T A 7: 112,381,916 (GRCm38) S366T possibly damaging Het
Mroh9 A T 1: 163,044,093 (GRCm38) I607N probably damaging Het
Mybphl T C 3: 108,374,163 (GRCm38) I65T possibly damaging Het
Myo1g A G 11: 6,517,874 (GRCm38) I187T probably damaging Het
Myo7b T C 18: 31,985,108 (GRCm38) S822G probably benign Het
Nkx2-4 C A 2: 147,084,922 (GRCm38) A142S probably benign Het
Obscn T C 11: 59,131,646 (GRCm38) R758G possibly damaging Het
Odf4 C T 11: 68,922,040 (GRCm38) S264N probably benign Het
Olfr360 G T 2: 37,068,343 (GRCm38) V13L probably benign Het
Olfr45 A T 7: 140,691,742 (GRCm38) Y279F probably damaging Het
Olfr657 A T 7: 104,636,424 (GRCm38) H250L probably damaging Het
Papolb T C 5: 142,529,178 (GRCm38) I237V probably benign Het
Parpbp T A 10: 88,093,702 (GRCm38) Q428L possibly damaging Het
Pcdhb16 T C 18: 37,479,834 (GRCm38) F616L probably damaging Het
Pdk3 A T X: 93,782,240 (GRCm38) M253K probably damaging Het
Pgap2 C A 7: 102,226,467 (GRCm38) probably benign Het
Pkhd1l1 C A 15: 44,550,885 (GRCm38) N2849K probably damaging Het
Pprc1 A G 19: 46,067,225 (GRCm38) probably benign Het
Psma2 A G 13: 14,616,845 (GRCm38) Y25C possibly damaging Het
Ptgir A G 7: 16,906,869 (GRCm38) M29V possibly damaging Het
Ptpn5 C A 7: 47,090,852 (GRCm38) probably benign Het
Pxn G T 5: 115,552,720 (GRCm38) probably benign Het
Scd3 C A 19: 44,215,439 (GRCm38) A22E probably benign Het
Sdr42e1 T C 8: 117,663,608 (GRCm38) E98G probably benign Het
Slc14a2 A C 18: 78,195,853 (GRCm38) S184A probably benign Het
Tmem236 A T 2: 14,219,153 (GRCm38) Q251L probably benign Het
Trappc8 T C 18: 20,874,672 (GRCm38) T129A probably benign Het
Vmn1r90 A C 7: 14,561,969 (GRCm38) M68R possibly damaging Het
Vmn2r105 A G 17: 20,226,351 (GRCm38) V462A probably benign Het
Vmn2r7 T C 3: 64,690,689 (GRCm38) T816A possibly damaging Het
Vmn2r81 T A 10: 79,268,407 (GRCm38) I288K possibly damaging Het
Zfp180 A C 7: 24,104,573 (GRCm38) K139T possibly damaging Het
Zfp932 T C 5: 110,009,639 (GRCm38) V401A probably benign Het
Other mutations in Dnah9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00696:Dnah9 APN 11 65,841,238 (GRCm38) splice site probably benign
IGL00805:Dnah9 APN 11 65,881,695 (GRCm38) missense probably benign 0.00
IGL00826:Dnah9 APN 11 65,989,942 (GRCm38) missense probably damaging 1.00
IGL01108:Dnah9 APN 11 65,849,980 (GRCm38) missense possibly damaging 0.93
IGL01152:Dnah9 APN 11 66,072,056 (GRCm38) missense probably damaging 1.00
IGL01353:Dnah9 APN 11 66,080,571 (GRCm38) missense probably damaging 1.00
IGL01364:Dnah9 APN 11 66,155,459 (GRCm38) missense probably damaging 1.00
IGL01479:Dnah9 APN 11 65,955,717 (GRCm38) missense probably benign 0.14
IGL01537:Dnah9 APN 11 65,947,680 (GRCm38) missense probably benign
IGL01565:Dnah9 APN 11 66,033,829 (GRCm38) missense possibly damaging 0.95
IGL01597:Dnah9 APN 11 66,118,830 (GRCm38) missense probably damaging 1.00
IGL01619:Dnah9 APN 11 65,831,615 (GRCm38) nonsense probably null
IGL01625:Dnah9 APN 11 66,044,645 (GRCm38) missense probably damaging 1.00
IGL01803:Dnah9 APN 11 66,118,829 (GRCm38) missense probably damaging 1.00
IGL01819:Dnah9 APN 11 66,108,126 (GRCm38) missense probably benign 0.33
IGL01896:Dnah9 APN 11 66,130,666 (GRCm38) missense possibly damaging 0.89
IGL01922:Dnah9 APN 11 66,075,034 (GRCm38) splice site probably benign
IGL01923:Dnah9 APN 11 66,125,235 (GRCm38) splice site probably benign
IGL02059:Dnah9 APN 11 66,072,958 (GRCm38) missense probably damaging 1.00
IGL02068:Dnah9 APN 11 66,061,045 (GRCm38) missense probably damaging 1.00
IGL02135:Dnah9 APN 11 66,117,492 (GRCm38) missense possibly damaging 0.63
IGL02146:Dnah9 APN 11 65,927,700 (GRCm38) missense probably damaging 1.00
IGL02264:Dnah9 APN 11 66,080,488 (GRCm38) splice site probably benign
IGL02325:Dnah9 APN 11 65,834,217 (GRCm38) missense probably damaging 1.00
IGL02426:Dnah9 APN 11 66,125,153 (GRCm38) missense probably benign
IGL02440:Dnah9 APN 11 65,955,246 (GRCm38) missense probably damaging 1.00
IGL02471:Dnah9 APN 11 65,947,618 (GRCm38) nonsense probably null
IGL02496:Dnah9 APN 11 66,029,363 (GRCm38) missense probably damaging 1.00
IGL02672:Dnah9 APN 11 65,927,601 (GRCm38) missense probably benign 0.02
IGL02718:Dnah9 APN 11 65,886,640 (GRCm38) missense probably damaging 0.99
IGL02832:Dnah9 APN 11 66,040,346 (GRCm38) missense probably damaging 1.00
IGL02851:Dnah9 APN 11 66,037,744 (GRCm38) splice site probably benign
IGL02859:Dnah9 APN 11 65,881,619 (GRCm38) splice site probably benign
IGL02864:Dnah9 APN 11 66,061,003 (GRCm38) missense probably damaging 1.00
IGL02954:Dnah9 APN 11 66,118,967 (GRCm38) missense probably damaging 1.00
IGL02987:Dnah9 APN 11 65,841,273 (GRCm38) missense probably benign 0.23
IGL02987:Dnah9 APN 11 65,855,272 (GRCm38) missense probably damaging 0.98
IGL03160:Dnah9 APN 11 66,108,054 (GRCm38) missense probably damaging 0.98
IGL03171:Dnah9 APN 11 65,981,241 (GRCm38) missense probably benign 0.13
IGL03180:Dnah9 APN 11 65,886,639 (GRCm38) missense probably damaging 0.99
IGL03388:Dnah9 APN 11 65,947,542 (GRCm38) missense probably damaging 1.00
anarchy UTSW 11 65,955,248 (GRCm38) missense probably damaging 0.99
sacco UTSW 11 66,168,079 (GRCm38) missense possibly damaging 0.82
Tweed UTSW 11 66,072,072 (GRCm38) missense probably damaging 0.99
vanzetti UTSW 11 65,855,372 (GRCm38) nonsense probably null
IGL02837:Dnah9 UTSW 11 65,874,196 (GRCm38) missense probably damaging 1.00
PIT4280001:Dnah9 UTSW 11 66,005,013 (GRCm38) missense probably benign 0.44
R0021:Dnah9 UTSW 11 65,969,979 (GRCm38) missense probably benign 0.36
R0021:Dnah9 UTSW 11 65,969,979 (GRCm38) missense probably benign 0.36
R0025:Dnah9 UTSW 11 65,969,955 (GRCm38) splice site probably benign
R0025:Dnah9 UTSW 11 65,969,955 (GRCm38) splice site probably benign
R0070:Dnah9 UTSW 11 66,160,040 (GRCm38) missense probably benign 0.10
R0164:Dnah9 UTSW 11 65,918,804 (GRCm38) nonsense probably null
R0164:Dnah9 UTSW 11 65,918,804 (GRCm38) nonsense probably null
R0180:Dnah9 UTSW 11 66,147,290 (GRCm38) missense probably damaging 1.00
R0195:Dnah9 UTSW 11 65,895,905 (GRCm38) missense probably benign 0.30
R0230:Dnah9 UTSW 11 65,855,315 (GRCm38) missense probably damaging 1.00
R0243:Dnah9 UTSW 11 65,911,852 (GRCm38) missense possibly damaging 0.91
R0279:Dnah9 UTSW 11 65,911,789 (GRCm38) critical splice donor site probably null
R0288:Dnah9 UTSW 11 66,025,134 (GRCm38) critical splice donor site probably null
R0309:Dnah9 UTSW 11 66,026,972 (GRCm38) splice site probably benign
R0356:Dnah9 UTSW 11 66,130,562 (GRCm38) critical splice donor site probably null
R0403:Dnah9 UTSW 11 66,084,789 (GRCm38) missense possibly damaging 0.90
R0413:Dnah9 UTSW 11 66,108,135 (GRCm38) missense probably damaging 1.00
R0448:Dnah9 UTSW 11 65,918,713 (GRCm38) splice site probably benign
R0496:Dnah9 UTSW 11 66,075,135 (GRCm38) missense probably null 1.00
R0557:Dnah9 UTSW 11 66,084,666 (GRCm38) missense probably damaging 1.00
R0584:Dnah9 UTSW 11 65,990,489 (GRCm38) missense probably damaging 1.00
R0598:Dnah9 UTSW 11 66,118,877 (GRCm38) missense probably benign 0.02
R0599:Dnah9 UTSW 11 65,965,689 (GRCm38) missense probably damaging 1.00
R0606:Dnah9 UTSW 11 65,841,333 (GRCm38) missense probably damaging 1.00
R0666:Dnah9 UTSW 11 66,085,458 (GRCm38) missense probably benign 0.01
R0715:Dnah9 UTSW 11 66,081,248 (GRCm38) splice site probably benign
R0726:Dnah9 UTSW 11 65,965,681 (GRCm38) missense probably damaging 1.00
R0737:Dnah9 UTSW 11 66,107,898 (GRCm38) missense probably damaging 1.00
R0763:Dnah9 UTSW 11 66,155,530 (GRCm38) missense probably benign 0.30
R0792:Dnah9 UTSW 11 65,896,001 (GRCm38) missense possibly damaging 0.84
R0829:Dnah9 UTSW 11 66,005,176 (GRCm38) missense probably benign 0.00
R0973:Dnah9 UTSW 11 66,005,837 (GRCm38) splice site probably null
R0974:Dnah9 UTSW 11 66,005,837 (GRCm38) splice site probably null
R1055:Dnah9 UTSW 11 66,160,011 (GRCm38) missense probably damaging 1.00
R1081:Dnah9 UTSW 11 66,084,877 (GRCm38) missense probably damaging 0.99
R1184:Dnah9 UTSW 11 66,084,612 (GRCm38) critical splice donor site probably null
R1225:Dnah9 UTSW 11 65,871,060 (GRCm38) missense possibly damaging 0.94
R1304:Dnah9 UTSW 11 65,927,588 (GRCm38) missense probably damaging 0.98
R1417:Dnah9 UTSW 11 65,955,747 (GRCm38) missense probably damaging 0.96
R1439:Dnah9 UTSW 11 65,874,132 (GRCm38) missense probably benign 0.22
R1447:Dnah9 UTSW 11 66,108,482 (GRCm38) missense possibly damaging 0.65
R1450:Dnah9 UTSW 11 65,927,786 (GRCm38) missense probably damaging 1.00
R1470:Dnah9 UTSW 11 65,927,822 (GRCm38) missense probably benign 0.11
R1470:Dnah9 UTSW 11 65,927,822 (GRCm38) missense probably benign 0.11
R1486:Dnah9 UTSW 11 65,834,272 (GRCm38) missense probably damaging 1.00
R1519:Dnah9 UTSW 11 65,881,761 (GRCm38) missense probably damaging 0.96
R1570:Dnah9 UTSW 11 66,112,330 (GRCm38) missense probably benign
R1617:Dnah9 UTSW 11 65,895,921 (GRCm38) missense probably damaging 1.00
R1623:Dnah9 UTSW 11 66,037,637 (GRCm38) missense probably damaging 1.00
R1626:Dnah9 UTSW 11 66,085,267 (GRCm38) missense probably benign 0.05
R1671:Dnah9 UTSW 11 65,927,963 (GRCm38) missense probably damaging 0.99
R1694:Dnah9 UTSW 11 65,954,824 (GRCm38) nonsense probably null
R1701:Dnah9 UTSW 11 65,911,924 (GRCm38) missense probably damaging 1.00
R1702:Dnah9 UTSW 11 66,085,195 (GRCm38) missense possibly damaging 0.72
R1708:Dnah9 UTSW 11 65,915,154 (GRCm38) missense probably benign 0.11
R1718:Dnah9 UTSW 11 66,168,079 (GRCm38) missense possibly damaging 0.82
R1729:Dnah9 UTSW 11 66,085,020 (GRCm38) missense possibly damaging 0.51
R1760:Dnah9 UTSW 11 65,981,222 (GRCm38) missense probably benign 0.31
R1784:Dnah9 UTSW 11 66,085,020 (GRCm38) missense possibly damaging 0.51
R1793:Dnah9 UTSW 11 66,119,594 (GRCm38) critical splice donor site probably null
R1801:Dnah9 UTSW 11 65,955,297 (GRCm38) missense probably damaging 0.99
R1827:Dnah9 UTSW 11 65,850,061 (GRCm38) missense probably damaging 0.97
R1836:Dnah9 UTSW 11 66,118,841 (GRCm38) missense probably benign 0.10
R1840:Dnah9 UTSW 11 65,834,198 (GRCm38) nonsense probably null
R1847:Dnah9 UTSW 11 65,834,386 (GRCm38) missense probably damaging 1.00
R1872:Dnah9 UTSW 11 66,037,490 (GRCm38) missense probably benign 0.16
R1929:Dnah9 UTSW 11 65,976,398 (GRCm38) missense probably benign 0.05
R1969:Dnah9 UTSW 11 65,848,371 (GRCm38) missense probably damaging 1.00
R1971:Dnah9 UTSW 11 65,848,371 (GRCm38) missense probably damaging 1.00
R2027:Dnah9 UTSW 11 65,955,338 (GRCm38) missense probably benign 0.11
R2049:Dnah9 UTSW 11 66,044,683 (GRCm38) missense probably damaging 1.00
R2064:Dnah9 UTSW 11 66,145,435 (GRCm38) missense probably benign 0.31
R2104:Dnah9 UTSW 11 66,061,124 (GRCm38) missense probably damaging 1.00
R2109:Dnah9 UTSW 11 66,037,585 (GRCm38) missense probably damaging 1.00
R2160:Dnah9 UTSW 11 66,117,483 (GRCm38) missense probably damaging 1.00
R2172:Dnah9 UTSW 11 66,072,779 (GRCm38) missense probably damaging 1.00
R2198:Dnah9 UTSW 11 65,859,499 (GRCm38) missense possibly damaging 0.50
R2271:Dnah9 UTSW 11 66,112,362 (GRCm38) missense probably benign 0.37
R2272:Dnah9 UTSW 11 66,112,362 (GRCm38) missense probably benign 0.37
R2396:Dnah9 UTSW 11 66,085,158 (GRCm38) missense probably benign 0.01
R2398:Dnah9 UTSW 11 65,915,203 (GRCm38) missense probably damaging 1.00
R2418:Dnah9 UTSW 11 66,095,415 (GRCm38) nonsense probably null
R2419:Dnah9 UTSW 11 66,095,415 (GRCm38) nonsense probably null
R2510:Dnah9 UTSW 11 66,005,169 (GRCm38) missense probably damaging 1.00
R2680:Dnah9 UTSW 11 66,033,925 (GRCm38) missense probably benign 0.00
R2875:Dnah9 UTSW 11 66,168,461 (GRCm38) missense possibly damaging 0.89
R2979:Dnah9 UTSW 11 66,117,588 (GRCm38) missense possibly damaging 0.89
R3236:Dnah9 UTSW 11 65,954,989 (GRCm38) missense probably benign 0.11
R3237:Dnah9 UTSW 11 65,954,989 (GRCm38) missense probably benign 0.11
R3433:Dnah9 UTSW 11 66,075,112 (GRCm38) missense possibly damaging 0.85
R3737:Dnah9 UTSW 11 66,156,908 (GRCm38) nonsense probably null
R3820:Dnah9 UTSW 11 65,851,003 (GRCm38) critical splice donor site probably null
R3821:Dnah9 UTSW 11 65,851,003 (GRCm38) critical splice donor site probably null
R3822:Dnah9 UTSW 11 65,851,003 (GRCm38) critical splice donor site probably null
R3861:Dnah9 UTSW 11 66,052,994 (GRCm38) splice site probably benign
R3918:Dnah9 UTSW 11 65,870,974 (GRCm38) missense possibly damaging 0.54
R4011:Dnah9 UTSW 11 65,834,464 (GRCm38) missense probably damaging 0.98
R4044:Dnah9 UTSW 11 66,133,635 (GRCm38) missense probably benign 0.03
R4072:Dnah9 UTSW 11 66,084,904 (GRCm38) missense probably benign 0.00
R4076:Dnah9 UTSW 11 66,084,904 (GRCm38) missense probably benign 0.00
R4097:Dnah9 UTSW 11 65,990,459 (GRCm38) missense probably damaging 1.00
R4409:Dnah9 UTSW 11 66,085,477 (GRCm38) missense possibly damaging 0.51
R4410:Dnah9 UTSW 11 66,085,477 (GRCm38) missense possibly damaging 0.51
R4417:Dnah9 UTSW 11 65,981,214 (GRCm38) missense possibly damaging 0.75
R4420:Dnah9 UTSW 11 66,118,749 (GRCm38) missense probably benign 0.00
R4434:Dnah9 UTSW 11 66,108,075 (GRCm38) missense possibly damaging 0.67
R4451:Dnah9 UTSW 11 65,881,641 (GRCm38) missense probably benign 0.07
R4452:Dnah9 UTSW 11 66,027,082 (GRCm38) missense probably damaging 0.96
R4454:Dnah9 UTSW 11 66,147,389 (GRCm38) missense probably damaging 0.96
R4552:Dnah9 UTSW 11 65,841,366 (GRCm38) missense probably damaging 1.00
R4590:Dnah9 UTSW 11 66,040,392 (GRCm38) missense probably damaging 1.00
R4595:Dnah9 UTSW 11 66,168,152 (GRCm38) missense probably benign
R4655:Dnah9 UTSW 11 65,955,732 (GRCm38) missense probably benign 0.00
R4667:Dnah9 UTSW 11 66,155,531 (GRCm38) missense probably benign
R4718:Dnah9 UTSW 11 66,085,473 (GRCm38) missense probably benign
R4720:Dnah9 UTSW 11 66,076,358 (GRCm38) missense probably damaging 1.00
R4734:Dnah9 UTSW 11 65,834,115 (GRCm38) missense probably damaging 1.00
R4749:Dnah9 UTSW 11 65,834,115 (GRCm38) missense probably damaging 1.00
R4765:Dnah9 UTSW 11 65,927,726 (GRCm38) missense probably damaging 1.00
R4905:Dnah9 UTSW 11 65,874,124 (GRCm38) nonsense probably null
R4963:Dnah9 UTSW 11 66,084,611 (GRCm38) splice site probably null
R5074:Dnah9 UTSW 11 65,850,040 (GRCm38) missense probably damaging 1.00
R5230:Dnah9 UTSW 11 66,084,666 (GRCm38) missense probably damaging 0.99
R5262:Dnah9 UTSW 11 66,112,333 (GRCm38) missense probably benign 0.34
R5364:Dnah9 UTSW 11 65,881,696 (GRCm38) missense possibly damaging 0.93
R5370:Dnah9 UTSW 11 66,029,354 (GRCm38) missense probably damaging 1.00
R5386:Dnah9 UTSW 11 66,029,356 (GRCm38) missense probably damaging 1.00
R5389:Dnah9 UTSW 11 66,095,314 (GRCm38) nonsense probably null
R5541:Dnah9 UTSW 11 66,145,336 (GRCm38) missense probably damaging 1.00
R5560:Dnah9 UTSW 11 65,881,740 (GRCm38) missense probably benign 0.00
R5576:Dnah9 UTSW 11 65,834,096 (GRCm38) splice site probably null
R5648:Dnah9 UTSW 11 65,927,755 (GRCm38) missense probably benign 0.00
R5653:Dnah9 UTSW 11 65,849,980 (GRCm38) missense probably damaging 0.99
R5713:Dnah9 UTSW 11 66,025,223 (GRCm38) missense possibly damaging 0.92
R5763:Dnah9 UTSW 11 65,955,239 (GRCm38) missense probably damaging 1.00
R5825:Dnah9 UTSW 11 66,126,601 (GRCm38) missense probably benign 0.01
R5831:Dnah9 UTSW 11 66,108,121 (GRCm38) missense probably benign 0.00
R5847:Dnah9 UTSW 11 66,095,240 (GRCm38) frame shift probably null
R5870:Dnah9 UTSW 11 66,085,210 (GRCm38) missense probably benign 0.01
R5902:Dnah9 UTSW 11 66,025,187 (GRCm38) missense probably benign 0.08
R5918:Dnah9 UTSW 11 65,834,199 (GRCm38) missense probably damaging 1.00
R5979:Dnah9 UTSW 11 65,834,481 (GRCm38) missense probably damaging 1.00
R6065:Dnah9 UTSW 11 66,145,397 (GRCm38) missense possibly damaging 0.65
R6065:Dnah9 UTSW 11 65,855,338 (GRCm38) missense probably benign 0.05
R6086:Dnah9 UTSW 11 66,085,174 (GRCm38) missense probably benign
R6086:Dnah9 UTSW 11 65,989,915 (GRCm38) missense probably damaging 0.99
R6102:Dnah9 UTSW 11 65,990,516 (GRCm38) missense probably damaging 0.97
R6120:Dnah9 UTSW 11 66,147,399 (GRCm38) missense probably benign
R6154:Dnah9 UTSW 11 65,855,338 (GRCm38) missense probably benign 0.00
R6262:Dnah9 UTSW 11 65,881,805 (GRCm38) splice site probably null
R6265:Dnah9 UTSW 11 66,168,094 (GRCm38) missense probably benign 0.04
R6290:Dnah9 UTSW 11 65,841,375 (GRCm38) missense probably damaging 1.00
R6345:Dnah9 UTSW 11 66,037,693 (GRCm38) missense probably damaging 0.97
R6357:Dnah9 UTSW 11 65,874,196 (GRCm38) missense probably damaging 1.00
R6534:Dnah9 UTSW 11 65,955,248 (GRCm38) missense probably damaging 0.99
R6574:Dnah9 UTSW 11 66,168,281 (GRCm38) missense probably benign 0.37
R6582:Dnah9 UTSW 11 66,061,097 (GRCm38) missense probably damaging 1.00
R6700:Dnah9 UTSW 11 65,955,366 (GRCm38) missense probably damaging 1.00
R6800:Dnah9 UTSW 11 66,072,739 (GRCm38) critical splice donor site probably null
R6812:Dnah9 UTSW 11 65,981,329 (GRCm38) missense probably damaging 0.99
R6931:Dnah9 UTSW 11 66,117,626 (GRCm38) missense possibly damaging 0.63
R6944:Dnah9 UTSW 11 66,085,149 (GRCm38) missense possibly damaging 0.91
R6958:Dnah9 UTSW 11 66,076,341 (GRCm38) missense probably damaging 1.00
R6977:Dnah9 UTSW 11 66,107,909 (GRCm38) missense probably benign 0.37
R7021:Dnah9 UTSW 11 65,981,231 (GRCm38) missense probably benign
R7161:Dnah9 UTSW 11 65,855,372 (GRCm38) nonsense probably null
R7175:Dnah9 UTSW 11 66,133,637 (GRCm38) missense probably benign 0.03
R7199:Dnah9 UTSW 11 66,118,944 (GRCm38) missense probably benign 0.04
R7231:Dnah9 UTSW 11 65,965,647 (GRCm38) missense probably damaging 1.00
R7284:Dnah9 UTSW 11 65,990,476 (GRCm38) missense probably damaging 0.99
R7314:Dnah9 UTSW 11 65,989,851 (GRCm38) missense probably benign 0.00
R7350:Dnah9 UTSW 11 66,080,578 (GRCm38) missense probably damaging 1.00
R7420:Dnah9 UTSW 11 66,117,407 (GRCm38) critical splice donor site probably null
R7427:Dnah9 UTSW 11 65,955,219 (GRCm38) missense probably benign
R7477:Dnah9 UTSW 11 65,992,731 (GRCm38) missense probably damaging 0.98
R7515:Dnah9 UTSW 11 65,841,414 (GRCm38) missense probably benign 0.01
R7521:Dnah9 UTSW 11 65,989,837 (GRCm38) missense probably damaging 0.98
R7573:Dnah9 UTSW 11 66,125,215 (GRCm38) missense probably benign 0.43
R7659:Dnah9 UTSW 11 65,989,780 (GRCm38) missense probably damaging 0.99
R7707:Dnah9 UTSW 11 66,118,958 (GRCm38) missense probably damaging 1.00
R7749:Dnah9 UTSW 11 65,911,830 (GRCm38) missense probably damaging 1.00
R7792:Dnah9 UTSW 11 65,850,013 (GRCm38) missense probably damaging 1.00
R7808:Dnah9 UTSW 11 66,005,805 (GRCm38) nonsense probably null
R7814:Dnah9 UTSW 11 66,005,660 (GRCm38) missense probably damaging 1.00
R7818:Dnah9 UTSW 11 66,025,211 (GRCm38) missense possibly damaging 0.64
R7890:Dnah9 UTSW 11 66,072,072 (GRCm38) missense probably damaging 0.99
R7976:Dnah9 UTSW 11 65,841,401 (GRCm38) missense possibly damaging 0.91
R8121:Dnah9 UTSW 11 66,017,375 (GRCm38) missense probably benign 0.02
R8232:Dnah9 UTSW 11 65,855,323 (GRCm38) missense possibly damaging 0.91
R8311:Dnah9 UTSW 11 65,989,818 (GRCm38) missense probably benign 0.00
R8326:Dnah9 UTSW 11 66,117,626 (GRCm38) missense probably benign 0.01
R8338:Dnah9 UTSW 11 65,841,241 (GRCm38) critical splice donor site probably null
R8356:Dnah9 UTSW 11 66,156,938 (GRCm38) missense probably damaging 0.99
R8456:Dnah9 UTSW 11 66,156,938 (GRCm38) missense probably damaging 0.99
R8468:Dnah9 UTSW 11 65,831,730 (GRCm38) missense probably benign 0.00
R8721:Dnah9 UTSW 11 66,095,298 (GRCm38) missense probably damaging 1.00
R8747:Dnah9 UTSW 11 65,927,990 (GRCm38) missense possibly damaging 0.69
R8798:Dnah9 UTSW 11 65,905,231 (GRCm38) missense probably damaging 0.99
R8806:Dnah9 UTSW 11 65,859,483 (GRCm38) missense probably damaging 1.00
R8826:Dnah9 UTSW 11 65,849,916 (GRCm38) missense probably benign 0.13
R8837:Dnah9 UTSW 11 65,855,234 (GRCm38) missense possibly damaging 0.72
R8886:Dnah9 UTSW 11 66,053,014 (GRCm38) missense probably damaging 1.00
R8887:Dnah9 UTSW 11 65,855,384 (GRCm38) missense probably benign 0.01
R8921:Dnah9 UTSW 11 65,911,921 (GRCm38) missense probably benign
R8933:Dnah9 UTSW 11 65,855,252 (GRCm38) missense possibly damaging 0.88
R8949:Dnah9 UTSW 11 66,168,400 (GRCm38) missense possibly damaging 0.91
R8967:Dnah9 UTSW 11 66,125,112 (GRCm38) critical splice donor site probably null
R8979:Dnah9 UTSW 11 66,005,152 (GRCm38) missense probably benign
R8991:Dnah9 UTSW 11 65,886,680 (GRCm38) missense probably damaging 0.96
R9016:Dnah9 UTSW 11 66,108,030 (GRCm38) missense probably damaging 0.99
R9025:Dnah9 UTSW 11 66,005,825 (GRCm38) missense probably damaging 1.00
R9043:Dnah9 UTSW 11 65,954,854 (GRCm38) missense
R9047:Dnah9 UTSW 11 66,072,099 (GRCm38) missense possibly damaging 0.89
R9076:Dnah9 UTSW 11 66,117,638 (GRCm38) missense probably benign 0.21
R9113:Dnah9 UTSW 11 65,989,887 (GRCm38) missense probably damaging 1.00
R9152:Dnah9 UTSW 11 66,130,631 (GRCm38) missense probably damaging 1.00
R9187:Dnah9 UTSW 11 66,005,146 (GRCm38) missense probably benign
R9198:Dnah9 UTSW 11 65,955,744 (GRCm38) missense probably benign 0.02
R9203:Dnah9 UTSW 11 65,855,287 (GRCm38) missense possibly damaging 0.58
R9234:Dnah9 UTSW 11 66,033,925 (GRCm38) missense possibly damaging 0.68
R9245:Dnah9 UTSW 11 65,895,905 (GRCm38) missense probably benign 0.30
R9265:Dnah9 UTSW 11 65,841,255 (GRCm38) missense probably benign 0.01
R9307:Dnah9 UTSW 11 66,085,474 (GRCm38) missense probably benign 0.14
R9336:Dnah9 UTSW 11 65,870,949 (GRCm38) missense probably damaging 1.00
R9386:Dnah9 UTSW 11 65,947,542 (GRCm38) missense probably damaging 1.00
R9498:Dnah9 UTSW 11 65,848,373 (GRCm38) missense probably damaging 0.99
R9508:Dnah9 UTSW 11 65,834,263 (GRCm38) missense probably damaging 1.00
R9524:Dnah9 UTSW 11 66,085,483 (GRCm38) missense possibly damaging 0.92
R9577:Dnah9 UTSW 11 65,976,521 (GRCm38) missense probably benign 0.00
R9583:Dnah9 UTSW 11 65,965,681 (GRCm38) missense probably damaging 1.00
R9587:Dnah9 UTSW 11 66,108,391 (GRCm38) missense probably null 0.92
R9612:Dnah9 UTSW 11 65,927,649 (GRCm38) missense probably benign 0.00
R9748:Dnah9 UTSW 11 66,085,464 (GRCm38) missense possibly damaging 0.51
R9749:Dnah9 UTSW 11 66,095,376 (GRCm38) missense probably damaging 1.00
R9759:Dnah9 UTSW 11 66,075,118 (GRCm38) missense probably null 0.93
R9784:Dnah9 UTSW 11 66,085,134 (GRCm38) missense probably damaging 0.99
V3553:Dnah9 UTSW 11 65,970,076 (GRCm38) missense probably damaging 1.00
X0027:Dnah9 UTSW 11 66,085,479 (GRCm38) missense probably benign 0.07
X0028:Dnah9 UTSW 11 65,990,452 (GRCm38) missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65,970,084 (GRCm38) missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65,927,853 (GRCm38) missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65,895,972 (GRCm38) missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 66,072,835 (GRCm38) missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 66,037,474 (GRCm38) missense probably damaging 1.00
Z1177:Dnah9 UTSW 11 66,126,650 (GRCm38) missense probably damaging 1.00
Z1186:Dnah9 UTSW 11 66,085,174 (GRCm38) missense probably benign
Z1186:Dnah9 UTSW 11 66,147,381 (GRCm38) missense probably benign
Z1187:Dnah9 UTSW 11 66,147,381 (GRCm38) missense probably benign
Z1187:Dnah9 UTSW 11 66,085,174 (GRCm38) missense probably benign
Z1188:Dnah9 UTSW 11 66,147,381 (GRCm38) missense probably benign
Z1188:Dnah9 UTSW 11 66,085,174 (GRCm38) missense probably benign
Z1189:Dnah9 UTSW 11 66,147,381 (GRCm38) missense probably benign
Z1189:Dnah9 UTSW 11 66,085,174 (GRCm38) missense probably benign
Z1190:Dnah9 UTSW 11 66,147,381 (GRCm38) missense probably benign
Z1190:Dnah9 UTSW 11 66,085,174 (GRCm38) missense probably benign
Z1191:Dnah9 UTSW 11 66,147,381 (GRCm38) missense probably benign
Z1191:Dnah9 UTSW 11 66,085,174 (GRCm38) missense probably benign
Z1192:Dnah9 UTSW 11 66,147,381 (GRCm38) missense probably benign
Z1192:Dnah9 UTSW 11 66,085,174 (GRCm38) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTGGGGTCCAGCCATGTC -3'
(R):5'- GTACCCTCAGATTCATGGTTTCTGTTG -3'

Sequencing Primer
(F):5'- AGCCATGTCCTCCCGCAATG -3'
(R):5'- CTGTACAAAGCAGCTTCTCTGAGG -3'
Posted On 2015-08-18