Incidental Mutation 'R4551:Kat6b'
ID333974
Institutional Source Beutler Lab
Gene Symbol Kat6b
Ensembl Gene ENSMUSG00000021767
Gene NameK(lysine) acetyltransferase 6B
SynonymsMyst4, monocytic leukemia, querkopf, B130044K16Rik, Morf, qkf
MMRRC Submission 041782-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.901) question?
Stock #R4551 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location21481434-21672478 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21661448 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 670 (E670G)
Ref Sequence ENSEMBL: ENSMUSP00000138511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069648] [ENSMUST00000112458] [ENSMUST00000182405] [ENSMUST00000182855] [ENSMUST00000182964]
Predicted Effect probably damaging
Transcript: ENSMUST00000069648
AA Change: E779G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000066693
Gene: ENSMUSG00000021767
AA Change: E779G

DomainStartEndE-ValueType
H15 94 171 1.7e-12 SMART
low complexity region 189 203 N/A INTRINSIC
PHD 216 271 6.6e-5 SMART
PHD 272 319 5.56e-12 SMART
low complexity region 386 398 N/A INTRINSIC
low complexity region 411 425 N/A INTRINSIC
Blast:PHD 483 573 3e-51 BLAST
Pfam:MOZ_SAS 594 772 4.5e-85 PFAM
coiled coil region 811 845 N/A INTRINSIC
coiled coil region 875 913 N/A INTRINSIC
low complexity region 926 943 N/A INTRINSIC
low complexity region 946 959 N/A INTRINSIC
low complexity region 1153 1175 N/A INTRINSIC
low complexity region 1207 1237 N/A INTRINSIC
low complexity region 1391 1410 N/A INTRINSIC
low complexity region 1450 1464 N/A INTRINSIC
low complexity region 1490 1517 N/A INTRINSIC
low complexity region 1676 1695 N/A INTRINSIC
low complexity region 1811 1832 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112458
SMART Domains Protein: ENSMUSP00000108077
Gene: ENSMUSG00000021767

DomainStartEndE-ValueType
H15 94 159 3.4e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182405
AA Change: E670G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138377
Gene: ENSMUSG00000021767
AA Change: E670G

DomainStartEndE-ValueType
H15 94 171 1.7e-12 SMART
low complexity region 189 203 N/A INTRINSIC
PHD 216 271 6.6e-5 SMART
PHD 272 319 5.56e-12 SMART
Pfam:MOZ_SAS 482 669 1.3e-89 PFAM
coiled coil region 702 736 N/A INTRINSIC
coiled coil region 766 804 N/A INTRINSIC
low complexity region 817 834 N/A INTRINSIC
low complexity region 837 850 N/A INTRINSIC
low complexity region 1044 1066 N/A INTRINSIC
low complexity region 1098 1128 N/A INTRINSIC
low complexity region 1282 1301 N/A INTRINSIC
low complexity region 1341 1355 N/A INTRINSIC
low complexity region 1381 1408 N/A INTRINSIC
low complexity region 1567 1586 N/A INTRINSIC
low complexity region 1702 1723 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182855
AA Change: E670G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138511
Gene: ENSMUSG00000021767
AA Change: E670G

DomainStartEndE-ValueType
H15 94 171 1.7e-12 SMART
low complexity region 189 203 N/A INTRINSIC
PHD 216 271 6.6e-5 SMART
PHD 272 319 5.56e-12 SMART
Pfam:MOZ_SAS 482 669 1.3e-89 PFAM
coiled coil region 702 736 N/A INTRINSIC
coiled coil region 766 804 N/A INTRINSIC
low complexity region 817 834 N/A INTRINSIC
low complexity region 837 850 N/A INTRINSIC
low complexity region 1044 1066 N/A INTRINSIC
low complexity region 1098 1128 N/A INTRINSIC
low complexity region 1282 1301 N/A INTRINSIC
low complexity region 1341 1355 N/A INTRINSIC
low complexity region 1381 1408 N/A INTRINSIC
low complexity region 1567 1586 N/A INTRINSIC
low complexity region 1702 1723 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182964
AA Change: E779G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138421
Gene: ENSMUSG00000021767
AA Change: E779G

DomainStartEndE-ValueType
H15 94 171 1.7e-12 SMART
low complexity region 189 203 N/A INTRINSIC
PHD 216 271 6.6e-5 SMART
PHD 272 319 5.56e-12 SMART
low complexity region 386 398 N/A INTRINSIC
low complexity region 411 425 N/A INTRINSIC
Blast:PHD 483 573 3e-51 BLAST
Pfam:MOZ_SAS 591 778 1.4e-89 PFAM
coiled coil region 811 845 N/A INTRINSIC
coiled coil region 875 913 N/A INTRINSIC
low complexity region 926 943 N/A INTRINSIC
low complexity region 946 959 N/A INTRINSIC
low complexity region 1153 1175 N/A INTRINSIC
low complexity region 1207 1237 N/A INTRINSIC
low complexity region 1391 1410 N/A INTRINSIC
low complexity region 1450 1464 N/A INTRINSIC
low complexity region 1490 1517 N/A INTRINSIC
low complexity region 1676 1695 N/A INTRINSIC
low complexity region 1811 1832 N/A INTRINSIC
Meta Mutation Damage Score 0.2054 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (71/71)
MGI Phenotype PHENOTYPE: Reduced expression of this gene results in developmental defects of the skeleton and brain, particularly the cerebral cortex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk T G 11: 120,011,569 E610A probably benign Het
Abhd17b T C 19: 21,680,926 S176P possibly damaging Het
Adgrg7 A G 16: 56,748,012 Y427H probably damaging Het
Alox15 T A 11: 70,344,596 I647L probably benign Het
Ankhd1 C A 18: 36,655,507 probably null Het
Arid1a A C 4: 133,695,699 probably benign Het
Armcx5 T A X: 135,746,507 V444D probably damaging Het
C4bp A G 1: 130,636,727 Y407H possibly damaging Het
Cog6 T A 3: 52,998,320 E96V probably damaging Het
Cox20 A C 1: 178,322,549 N96T probably benign Het
Cpa3 T C 3: 20,219,770 I351V probably benign Het
Cpd C T 11: 76,811,886 G552D probably damaging Het
Cyld A G 8: 88,707,134 K184E possibly damaging Het
Dab2 G A 15: 6,435,294 G324D probably damaging Het
Depdc1a T A 3: 159,522,584 D324E probably damaging Het
Dnah9 T C 11: 65,841,366 E4238G probably damaging Het
Dync1i1 T A 6: 5,923,206 D275E probably benign Het
Epgn A T 5: 91,027,562 K14* probably null Het
Farp2 T A 1: 93,618,592 L868Q possibly damaging Het
Gpr45 A G 1: 43,032,790 T198A probably benign Het
Grk2 C T 19: 4,286,056 V402M possibly damaging Het
Gsap A T 5: 21,290,571 D79V probably damaging Het
Gtf2h3 A G 5: 124,590,419 probably benign Het
Hus1b C A 13: 30,947,076 S200I probably damaging Het
Hypk A G 2: 121,453,480 probably null Het
Ikbke T C 1: 131,258,033 probably benign Het
Kif26b T A 1: 178,884,035 I740N probably damaging Het
Lhx3 G A 2: 26,201,190 P369L probably damaging Het
Man2c1 T C 9: 57,131,161 L35P probably damaging Het
Micalcl T A 7: 112,381,916 S366T possibly damaging Het
Mroh9 A T 1: 163,044,093 I607N probably damaging Het
Mybphl T C 3: 108,374,163 I65T possibly damaging Het
Myo1g A G 11: 6,517,874 I187T probably damaging Het
Myo7b T C 18: 31,985,108 S822G probably benign Het
Nkx2-4 C A 2: 147,084,922 A142S probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Odf4 C T 11: 68,922,040 S264N probably benign Het
Olfr360 G T 2: 37,068,343 V13L probably benign Het
Olfr45 A T 7: 140,691,742 Y279F probably damaging Het
Olfr657 A T 7: 104,636,424 H250L probably damaging Het
Papolb T C 5: 142,529,178 I237V probably benign Het
Parpbp T A 10: 88,093,702 Q428L possibly damaging Het
Pcdhb16 T C 18: 37,479,834 F616L probably damaging Het
Pdk3 A T X: 93,782,240 M253K probably damaging Het
Pgap2 C A 7: 102,226,467 probably benign Het
Pkhd1l1 C A 15: 44,550,885 N2849K probably damaging Het
Pprc1 A G 19: 46,067,225 probably benign Het
Psma2 A G 13: 14,616,845 Y25C possibly damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptpn5 C A 7: 47,090,852 probably benign Het
Pxn G T 5: 115,552,720 probably benign Het
Scd3 C A 19: 44,215,439 A22E probably benign Het
Sdr42e1 T C 8: 117,663,608 E98G probably benign Het
Slc14a2 A C 18: 78,195,853 S184A probably benign Het
Tmem236 A T 2: 14,219,153 Q251L probably benign Het
Trappc8 T C 18: 20,874,672 T129A probably benign Het
Vmn1r90 A C 7: 14,561,969 M68R possibly damaging Het
Vmn2r105 A G 17: 20,226,351 V462A probably benign Het
Vmn2r7 T C 3: 64,690,689 T816A possibly damaging Het
Vmn2r81 T A 10: 79,268,407 I288K possibly damaging Het
Zfp180 A C 7: 24,104,573 K139T possibly damaging Het
Zfp932 T C 5: 110,009,639 V401A probably benign Het
Other mutations in Kat6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Kat6b APN 14 21668559 missense probably benign 0.00
IGL01128:Kat6b APN 14 21660860 missense probably benign
IGL02272:Kat6b APN 14 21626778 missense probably damaging 0.99
IGL02349:Kat6b APN 14 21637593 missense probably damaging 0.99
IGL02402:Kat6b APN 14 21631347 missense probably damaging 1.00
IGL02474:Kat6b APN 14 21669039 missense possibly damaging 0.95
IGL02516:Kat6b APN 14 21609868 splice site probably benign
IGL02666:Kat6b APN 14 21628870 missense probably damaging 1.00
IGL02971:Kat6b APN 14 21669758 missense probably damaging 1.00
IGL03075:Kat6b APN 14 21661570 nonsense probably null
IGL03274:Kat6b APN 14 21609763 missense possibly damaging 0.95
IGL03308:Kat6b APN 14 21624834 missense probably damaging 0.99
R0118:Kat6b UTSW 14 21669974 missense probably damaging 0.99
R0383:Kat6b UTSW 14 21669081 missense probably benign 0.02
R0441:Kat6b UTSW 14 21670233 missense probably damaging 1.00
R0457:Kat6b UTSW 14 21670530 missense probably damaging 0.96
R0558:Kat6b UTSW 14 21669421 missense probably benign 0.03
R0662:Kat6b UTSW 14 21662349 small deletion probably benign
R0684:Kat6b UTSW 14 21668781 missense probably benign
R0755:Kat6b UTSW 14 21637593 missense probably damaging 0.99
R1216:Kat6b UTSW 14 21622040 nonsense probably null
R1479:Kat6b UTSW 14 21618956 missense probably benign 0.19
R1873:Kat6b UTSW 14 21516989 missense probably damaging 1.00
R1957:Kat6b UTSW 14 21628879 missense probably damaging 1.00
R2151:Kat6b UTSW 14 21668667 missense probably benign 0.02
R2152:Kat6b UTSW 14 21668667 missense probably benign 0.02
R2153:Kat6b UTSW 14 21668667 missense probably benign 0.02
R2154:Kat6b UTSW 14 21668667 missense probably benign 0.02
R2399:Kat6b UTSW 14 21662349 small deletion probably benign
R3740:Kat6b UTSW 14 21670044 missense probably damaging 0.99
R3771:Kat6b UTSW 14 21517098 missense probably damaging 1.00
R4178:Kat6b UTSW 14 21618904 nonsense probably null
R4261:Kat6b UTSW 14 21669669 missense probably damaging 1.00
R4724:Kat6b UTSW 14 21660962 missense probably benign
R5055:Kat6b UTSW 14 21516994 missense probably damaging 0.99
R5098:Kat6b UTSW 14 21619015 splice site probably benign
R5121:Kat6b UTSW 14 21619258 missense probably damaging 0.98
R5158:Kat6b UTSW 14 21669986 missense possibly damaging 0.93
R5488:Kat6b UTSW 14 21669264 missense probably damaging 1.00
R5489:Kat6b UTSW 14 21669264 missense probably damaging 1.00
R5653:Kat6b UTSW 14 21669372 missense probably benign 0.10
R5742:Kat6b UTSW 14 21668435 missense probably damaging 0.99
R5868:Kat6b UTSW 14 21634479 missense probably damaging 1.00
R5969:Kat6b UTSW 14 21670792 missense probably damaging 0.97
R6110:Kat6b UTSW 14 21670487 missense probably damaging 1.00
R6427:Kat6b UTSW 14 21517412 missense probably benign 0.24
R6457:Kat6b UTSW 14 21670680 missense probably damaging 1.00
R6639:Kat6b UTSW 14 21517494 missense possibly damaging 0.57
R6891:Kat6b UTSW 14 21669036 missense probably benign 0.01
R7784:Kat6b UTSW 14 21660841 missense probably damaging 1.00
R7916:Kat6b UTSW 14 21662349 small deletion probably benign
R7977:Kat6b UTSW 14 21669863 missense probably benign 0.00
R7987:Kat6b UTSW 14 21669863 missense probably benign 0.00
R8167:Kat6b UTSW 14 21669885 missense probably damaging 1.00
R8266:Kat6b UTSW 14 21516845 start gained probably benign
R8483:Kat6b UTSW 14 21669393 missense probably damaging 1.00
R8902:Kat6b UTSW 14 21669561 missense probably benign 0.30
R8909:Kat6b UTSW 14 21669146 missense probably benign
R8931:Kat6b UTSW 14 21624927 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTCAAAGGAATCTGGATTGGCC -3'
(R):5'- AGTCACCACTCAGGATGACTCG -3'

Sequencing Primer
(F):5'- TCTAGACAGGGCCTCACTGTATAG -3'
(R):5'- GACTCGTCATCACCTCCTTCTCAG -3'
Posted On2015-08-18