Incidental Mutation 'R4551:Grk2'
ID333983
Institutional Source Beutler Lab
Gene Symbol Grk2
Ensembl Gene ENSMUSG00000024858
Gene NameG protein-coupled receptor kinase 2
SynonymsAdrbk-1, beta-adrenergic receptor kinase-1, beta-AR kinase-1, Bark-1, beta ARK, beta ARK1, betaARK1, Adrbk1
MMRRC Submission 041782-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4551 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location4286001-4306222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 4286056 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 402 (V402M)
Ref Sequence ENSEMBL: ENSMUSP00000126930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025791] [ENSMUST00000056888] [ENSMUST00000088737] [ENSMUST00000113837] [ENSMUST00000163858] [ENSMUST00000167215] [ENSMUST00000169192] [ENSMUST00000171123]
Predicted Effect probably benign
Transcript: ENSMUST00000025791
SMART Domains Protein: ENSMUSP00000025791
Gene: ENSMUSG00000024858

DomainStartEndE-ValueType
RGS 12 133 3.17e-30 SMART
S_TKc 149 411 2.43e-86 SMART
S_TK_X 412 491 5.3e-9 SMART
PH 517 612 2.79e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000056888
SMART Domains Protein: ENSMUSP00000053783
Gene: ENSMUSG00000005986

DomainStartEndE-ValueType
ANK 39 68 2.77e-3 SMART
ANK 72 101 9.75e1 SMART
Pfam:GPCR_chapero_1 155 469 1.2e-111 PFAM
UIM 482 501 3.2e-2 SMART
UIM 528 547 1.92e2 SMART
UIM 564 583 8.18e0 SMART
UIM 589 605 6e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088737
SMART Domains Protein: ENSMUSP00000086114
Gene: ENSMUSG00000024858

DomainStartEndE-ValueType
RGS 54 175 3.17e-30 SMART
S_TKc 191 453 2.43e-86 SMART
S_TK_X 454 533 5.3e-9 SMART
PH 559 654 2.79e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113837
SMART Domains Protein: ENSMUSP00000109468
Gene: ENSMUSG00000024858

DomainStartEndE-ValueType
RGS 54 175 3.17e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163858
SMART Domains Protein: ENSMUSP00000128932
Gene: ENSMUSG00000005986

DomainStartEndE-ValueType
ANK 39 68 2.77e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164427
Predicted Effect probably benign
Transcript: ENSMUST00000165954
SMART Domains Protein: ENSMUSP00000128177
Gene: ENSMUSG00000024858

DomainStartEndE-ValueType
Pfam:Pkinase 1 169 5.8e-46 PFAM
Pfam:Pkinase_Tyr 2 155 9.3e-20 PFAM
S_TK_X 170 208 3.39e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167215
SMART Domains Protein: ENSMUSP00000128037
Gene: ENSMUSG00000005986

DomainStartEndE-ValueType
ANK 39 68 2.77e-3 SMART
ANK 72 101 9.75e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168594
SMART Domains Protein: ENSMUSP00000126025
Gene: ENSMUSG00000024858

DomainStartEndE-ValueType
Blast:S_TKc 2 38 2e-18 BLAST
S_TK_X 39 85 2.95e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169192
SMART Domains Protein: ENSMUSP00000130995
Gene: ENSMUSG00000005986

DomainStartEndE-ValueType
Blast:ANK 1 28 5e-11 BLAST
Pfam:GPCR_chapero_1 82 121 6.9e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169653
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169991
Predicted Effect possibly damaging
Transcript: ENSMUST00000171123
AA Change: V402M

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126930
Gene: ENSMUSG00000024858
AA Change: V402M

DomainStartEndE-ValueType
RGS 54 175 3.17e-30 SMART
Pfam:Pkinase_Tyr 191 378 1.1e-21 PFAM
Pfam:Pkinase 191 381 4.9e-50 PFAM
Meta Mutation Damage Score 0.0841 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene phosphorylates the beta-2-adrenergic receptor and appears to mediate agonist-specific desensitization observed at high agonist concentrations. This protein is an ubiquitous cytosolic enzyme that specifically phosphorylates the activated form of the beta-adrenergic and related G-protein-coupled receptors. Abnormal coupling of beta-adrenergic receptor to G protein is involved in the pathogenesis of the failing heart. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality likely due to heart failure. Homozygous mutant embryos are pale in appearance and exhibit ventricular hypoplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk T G 11: 120,011,569 E610A probably benign Het
Abhd17b T C 19: 21,680,926 S176P possibly damaging Het
Adgrg7 A G 16: 56,748,012 Y427H probably damaging Het
Alox15 T A 11: 70,344,596 I647L probably benign Het
Ankhd1 C A 18: 36,655,507 probably null Het
Arid1a A C 4: 133,695,699 probably benign Het
Armcx5 T A X: 135,746,507 V444D probably damaging Het
C4bp A G 1: 130,636,727 Y407H possibly damaging Het
Cog6 T A 3: 52,998,320 E96V probably damaging Het
Cox20 A C 1: 178,322,549 N96T probably benign Het
Cpa3 T C 3: 20,219,770 I351V probably benign Het
Cpd C T 11: 76,811,886 G552D probably damaging Het
Cyld A G 8: 88,707,134 K184E possibly damaging Het
Dab2 G A 15: 6,435,294 G324D probably damaging Het
Depdc1a T A 3: 159,522,584 D324E probably damaging Het
Dnah9 T C 11: 65,841,366 E4238G probably damaging Het
Dync1i1 T A 6: 5,923,206 D275E probably benign Het
Epgn A T 5: 91,027,562 K14* probably null Het
Farp2 T A 1: 93,618,592 L868Q possibly damaging Het
Gpr45 A G 1: 43,032,790 T198A probably benign Het
Gsap A T 5: 21,290,571 D79V probably damaging Het
Gtf2h3 A G 5: 124,590,419 probably benign Het
Hus1b C A 13: 30,947,076 S200I probably damaging Het
Hypk A G 2: 121,453,480 probably null Het
Ikbke T C 1: 131,258,033 probably benign Het
Kat6b A G 14: 21,661,448 E670G probably damaging Het
Kif26b T A 1: 178,884,035 I740N probably damaging Het
Lhx3 G A 2: 26,201,190 P369L probably damaging Het
Man2c1 T C 9: 57,131,161 L35P probably damaging Het
Micalcl T A 7: 112,381,916 S366T possibly damaging Het
Mroh9 A T 1: 163,044,093 I607N probably damaging Het
Mybphl T C 3: 108,374,163 I65T possibly damaging Het
Myo1g A G 11: 6,517,874 I187T probably damaging Het
Myo7b T C 18: 31,985,108 S822G probably benign Het
Nkx2-4 C A 2: 147,084,922 A142S probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Odf4 C T 11: 68,922,040 S264N probably benign Het
Olfr360 G T 2: 37,068,343 V13L probably benign Het
Olfr45 A T 7: 140,691,742 Y279F probably damaging Het
Olfr657 A T 7: 104,636,424 H250L probably damaging Het
Papolb T C 5: 142,529,178 I237V probably benign Het
Parpbp T A 10: 88,093,702 Q428L possibly damaging Het
Pcdhb16 T C 18: 37,479,834 F616L probably damaging Het
Pdk3 A T X: 93,782,240 M253K probably damaging Het
Pgap2 C A 7: 102,226,467 probably benign Het
Pkhd1l1 C A 15: 44,550,885 N2849K probably damaging Het
Pprc1 A G 19: 46,067,225 probably benign Het
Psma2 A G 13: 14,616,845 Y25C possibly damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptpn5 C A 7: 47,090,852 probably benign Het
Pxn G T 5: 115,552,720 probably benign Het
Scd3 C A 19: 44,215,439 A22E probably benign Het
Sdr42e1 T C 8: 117,663,608 E98G probably benign Het
Slc14a2 A C 18: 78,195,853 S184A probably benign Het
Tmem236 A T 2: 14,219,153 Q251L probably benign Het
Trappc8 T C 18: 20,874,672 T129A probably benign Het
Vmn1r90 A C 7: 14,561,969 M68R possibly damaging Het
Vmn2r105 A G 17: 20,226,351 V462A probably benign Het
Vmn2r7 T C 3: 64,690,689 T816A possibly damaging Het
Vmn2r81 T A 10: 79,268,407 I288K possibly damaging Het
Zfp180 A C 7: 24,104,573 K139T possibly damaging Het
Zfp932 T C 5: 110,009,639 V401A probably benign Het
Other mutations in Grk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Grk2 APN 19 4289311 critical splice donor site probably null
IGL00927:Grk2 APN 19 4287954 missense probably benign 0.09
IGL01465:Grk2 APN 19 4290858 missense probably damaging 1.00
IGL02692:Grk2 APN 19 4290688 splice site probably benign
IGL02870:Grk2 APN 19 4290402 missense probably damaging 1.00
IGL03210:Grk2 APN 19 4287829 missense probably benign 0.01
IGL03227:Grk2 APN 19 4287829 missense probably benign 0.01
IGL03230:Grk2 APN 19 4287829 missense probably benign 0.01
PIT4480001:Grk2 UTSW 19 4287409 missense possibly damaging 0.93
R0008:Grk2 UTSW 19 4287234 missense probably damaging 0.99
R0371:Grk2 UTSW 19 4291586 splice site probably null
R0426:Grk2 UTSW 19 4290600 unclassified probably null
R0494:Grk2 UTSW 19 4291319 missense probably damaging 1.00
R0833:Grk2 UTSW 19 4289357 missense probably damaging 1.00
R1240:Grk2 UTSW 19 4290679 missense probably damaging 1.00
R1446:Grk2 UTSW 19 4287409 missense possibly damaging 0.93
R1499:Grk2 UTSW 19 4287194 missense probably benign 0.11
R1664:Grk2 UTSW 19 4287240 missense possibly damaging 0.48
R1796:Grk2 UTSW 19 4287940 missense probably benign 0.12
R1803:Grk2 UTSW 19 4294883 missense probably damaging 1.00
R2021:Grk2 UTSW 19 4290670 missense probably damaging 1.00
R3947:Grk2 UTSW 19 4292417 missense possibly damaging 0.95
R4945:Grk2 UTSW 19 4290447 missense probably damaging 1.00
R5299:Grk2 UTSW 19 4292771 missense probably damaging 1.00
R5753:Grk2 UTSW 19 4290468 missense probably damaging 1.00
R5754:Grk2 UTSW 19 4290468 missense probably damaging 1.00
R5973:Grk2 UTSW 19 4287897 missense possibly damaging 0.88
R6026:Grk2 UTSW 19 4290783 missense probably damaging 0.99
R7117:Grk2 UTSW 19 4290602 critical splice donor site probably null
R7468:Grk2 UTSW 19 4306035 start gained probably benign
R7764:Grk2 UTSW 19 4287363 missense probably damaging 1.00
X0009:Grk2 UTSW 19 4291589 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCTGACGAGAACTACTACGG -3'
(R):5'- TAGCCCATGTCATGTCAGTGG -3'

Sequencing Primer
(F):5'- GAGAACTACTACGGCTACTCCTG -3'
(R):5'- ATGACCCCTTGTGCCAG -3'
Posted On2015-08-18