Incidental Mutation 'R4551:Pprc1'
ID333986
Institutional Source Beutler Lab
Gene Symbol Pprc1
Ensembl Gene ENSMUSG00000055491
Gene Nameperoxisome proliferative activated receptor, gamma, coactivator-related 1
Synonyms
MMRRC Submission 041782-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4551 (G1)
Quality Score178
Status Validated
Chromosome19
Chromosomal Location46044886-46072915 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 46067225 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062322] [ENSMUST00000099392] [ENSMUST00000111899] [ENSMUST00000126127] [ENSMUST00000135327] [ENSMUST00000147640] [ENSMUST00000150158]
Predicted Effect probably benign
Transcript: ENSMUST00000062322
SMART Domains Protein: ENSMUSP00000079389
Gene: ENSMUSG00000055491

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
low complexity region 214 240 N/A INTRINSIC
low complexity region 448 459 N/A INTRINSIC
low complexity region 516 525 N/A INTRINSIC
low complexity region 646 661 N/A INTRINSIC
low complexity region 732 739 N/A INTRINSIC
low complexity region 826 887 N/A INTRINSIC
low complexity region 915 925 N/A INTRINSIC
low complexity region 939 960 N/A INTRINSIC
low complexity region 979 991 N/A INTRINSIC
low complexity region 1020 1033 N/A INTRINSIC
low complexity region 1224 1240 N/A INTRINSIC
low complexity region 1397 1446 N/A INTRINSIC
low complexity region 1453 1504 N/A INTRINSIC
RRM 1526 1597 3.36e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099392
SMART Domains Protein: ENSMUSP00000096990
Gene: ENSMUSG00000055491

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
low complexity region 210 236 N/A INTRINSIC
low complexity region 444 455 N/A INTRINSIC
low complexity region 512 521 N/A INTRINSIC
low complexity region 642 657 N/A INTRINSIC
low complexity region 728 735 N/A INTRINSIC
low complexity region 822 883 N/A INTRINSIC
low complexity region 911 921 N/A INTRINSIC
low complexity region 935 956 N/A INTRINSIC
low complexity region 975 987 N/A INTRINSIC
low complexity region 1016 1029 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111899
SMART Domains Protein: ENSMUSP00000107530
Gene: ENSMUSG00000055491

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
low complexity region 213 239 N/A INTRINSIC
low complexity region 447 458 N/A INTRINSIC
low complexity region 515 524 N/A INTRINSIC
low complexity region 645 660 N/A INTRINSIC
low complexity region 731 738 N/A INTRINSIC
low complexity region 825 886 N/A INTRINSIC
low complexity region 914 924 N/A INTRINSIC
low complexity region 938 959 N/A INTRINSIC
low complexity region 978 990 N/A INTRINSIC
low complexity region 1019 1032 N/A INTRINSIC
low complexity region 1222 1238 N/A INTRINSIC
low complexity region 1395 1444 N/A INTRINSIC
low complexity region 1451 1502 N/A INTRINSIC
RRM 1524 1595 3.36e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126127
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133101
Predicted Effect probably benign
Transcript: ENSMUST00000135327
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146882
Predicted Effect probably benign
Transcript: ENSMUST00000147640
Predicted Effect probably benign
Transcript: ENSMUST00000150158
SMART Domains Protein: ENSMUSP00000120475
Gene: ENSMUSG00000055491

DomainStartEndE-ValueType
low complexity region 70 86 N/A INTRINSIC
low complexity region 102 128 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153111
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to PPAR-gamma coactivator 1 (PPARGC1/PGC-1), a protein that can activate mitochondrial biogenesis in part through a direct interaction with nuclear respiratory factor 1 (NRF1). This protein has been shown to interact with NRF1. It is thought to be a functional relative of PPAR-gamma coactivator 1 that activates mitochondrial biogenesis through NRF1 in response to proliferative signals. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit letahlity post-implantation with delayed hatching and disorganized embryo tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk T G 11: 120,011,569 E610A probably benign Het
Abhd17b T C 19: 21,680,926 S176P possibly damaging Het
Adgrg7 A G 16: 56,748,012 Y427H probably damaging Het
Alox15 T A 11: 70,344,596 I647L probably benign Het
Ankhd1 C A 18: 36,655,507 probably null Het
Arid1a A C 4: 133,695,699 probably benign Het
Armcx5 T A X: 135,746,507 V444D probably damaging Het
C4bp A G 1: 130,636,727 Y407H possibly damaging Het
Cog6 T A 3: 52,998,320 E96V probably damaging Het
Cox20 A C 1: 178,322,549 N96T probably benign Het
Cpa3 T C 3: 20,219,770 I351V probably benign Het
Cpd C T 11: 76,811,886 G552D probably damaging Het
Cyld A G 8: 88,707,134 K184E possibly damaging Het
Dab2 G A 15: 6,435,294 G324D probably damaging Het
Depdc1a T A 3: 159,522,584 D324E probably damaging Het
Dnah9 T C 11: 65,841,366 E4238G probably damaging Het
Dync1i1 T A 6: 5,923,206 D275E probably benign Het
Epgn A T 5: 91,027,562 K14* probably null Het
Farp2 T A 1: 93,618,592 L868Q possibly damaging Het
Gpr45 A G 1: 43,032,790 T198A probably benign Het
Grk2 C T 19: 4,286,056 V402M possibly damaging Het
Gsap A T 5: 21,290,571 D79V probably damaging Het
Gtf2h3 A G 5: 124,590,419 probably benign Het
Hus1b C A 13: 30,947,076 S200I probably damaging Het
Hypk A G 2: 121,453,480 probably null Het
Ikbke T C 1: 131,258,033 probably benign Het
Kat6b A G 14: 21,661,448 E670G probably damaging Het
Kif26b T A 1: 178,884,035 I740N probably damaging Het
Lhx3 G A 2: 26,201,190 P369L probably damaging Het
Man2c1 T C 9: 57,131,161 L35P probably damaging Het
Micalcl T A 7: 112,381,916 S366T possibly damaging Het
Mroh9 A T 1: 163,044,093 I607N probably damaging Het
Mybphl T C 3: 108,374,163 I65T possibly damaging Het
Myo1g A G 11: 6,517,874 I187T probably damaging Het
Myo7b T C 18: 31,985,108 S822G probably benign Het
Nkx2-4 C A 2: 147,084,922 A142S probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Odf4 C T 11: 68,922,040 S264N probably benign Het
Olfr360 G T 2: 37,068,343 V13L probably benign Het
Olfr45 A T 7: 140,691,742 Y279F probably damaging Het
Olfr657 A T 7: 104,636,424 H250L probably damaging Het
Papolb T C 5: 142,529,178 I237V probably benign Het
Parpbp T A 10: 88,093,702 Q428L possibly damaging Het
Pcdhb16 T C 18: 37,479,834 F616L probably damaging Het
Pdk3 A T X: 93,782,240 M253K probably damaging Het
Pgap2 C A 7: 102,226,467 probably benign Het
Pkhd1l1 C A 15: 44,550,885 N2849K probably damaging Het
Psma2 A G 13: 14,616,845 Y25C possibly damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptpn5 C A 7: 47,090,852 probably benign Het
Pxn G T 5: 115,552,720 probably benign Het
Scd3 C A 19: 44,215,439 A22E probably benign Het
Sdr42e1 T C 8: 117,663,608 E98G probably benign Het
Slc14a2 A C 18: 78,195,853 S184A probably benign Het
Tmem236 A T 2: 14,219,153 Q251L probably benign Het
Trappc8 T C 18: 20,874,672 T129A probably benign Het
Vmn1r90 A C 7: 14,561,969 M68R possibly damaging Het
Vmn2r105 A G 17: 20,226,351 V462A probably benign Het
Vmn2r7 T C 3: 64,690,689 T816A possibly damaging Het
Vmn2r81 T A 10: 79,268,407 I288K possibly damaging Het
Zfp180 A C 7: 24,104,573 K139T possibly damaging Het
Zfp932 T C 5: 110,009,639 V401A probably benign Het
Other mutations in Pprc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Pprc1 APN 19 46062648 missense possibly damaging 0.93
IGL00825:Pprc1 APN 19 46071406 unclassified probably benign
IGL01445:Pprc1 APN 19 46065232 unclassified probably benign
IGL01449:Pprc1 APN 19 46065232 unclassified probably benign
IGL01475:Pprc1 APN 19 46071529 missense probably benign 0.03
IGL01750:Pprc1 APN 19 46071829 unclassified probably benign
IGL01779:Pprc1 APN 19 46062202 missense probably damaging 1.00
IGL01943:Pprc1 APN 19 46064544 unclassified probably benign
IGL02031:Pprc1 APN 19 46072343 unclassified probably benign
IGL02145:Pprc1 APN 19 46064890 unclassified probably benign
IGL02206:Pprc1 APN 19 46071751 missense probably damaging 0.98
IGL02439:Pprc1 APN 19 46072319 missense possibly damaging 0.94
IGL02675:Pprc1 APN 19 46063507 missense probably damaging 1.00
IGL03185:Pprc1 APN 19 46069747 intron probably benign
IGL03325:Pprc1 APN 19 46061509 missense possibly damaging 0.86
R0125:Pprc1 UTSW 19 46069512 intron probably benign
R0388:Pprc1 UTSW 19 46062775 missense possibly damaging 0.85
R0498:Pprc1 UTSW 19 46071568 nonsense probably null
R1129:Pprc1 UTSW 19 46063806 missense probably benign 0.35
R1439:Pprc1 UTSW 19 46063736 missense possibly damaging 0.94
R1536:Pprc1 UTSW 19 46071526 unclassified probably benign
R4698:Pprc1 UTSW 19 46069195 intron probably benign
R4822:Pprc1 UTSW 19 46071356 unclassified probably benign
R4909:Pprc1 UTSW 19 46064319 missense probably damaging 0.99
R4931:Pprc1 UTSW 19 46071316 unclassified probably benign
R5132:Pprc1 UTSW 19 46072682 unclassified probably benign
R5157:Pprc1 UTSW 19 46064758 unclassified probably benign
R5834:Pprc1 UTSW 19 46065220 unclassified probably benign
R5938:Pprc1 UTSW 19 46071316 unclassified probably benign
R5947:Pprc1 UTSW 19 46063672 missense possibly damaging 0.85
R5975:Pprc1 UTSW 19 46065370 unclassified probably benign
R6009:Pprc1 UTSW 19 46071732 missense probably damaging 1.00
R6259:Pprc1 UTSW 19 46064410 missense probably damaging 0.97
R6954:Pprc1 UTSW 19 46064433 missense probably damaging 0.96
R7287:Pprc1 UTSW 19 46071354 missense unknown
R7355:Pprc1 UTSW 19 46065346 missense unknown
R7527:Pprc1 UTSW 19 46069365 missense unknown
R7632:Pprc1 UTSW 19 46072282 missense probably damaging 1.00
R7745:Pprc1 UTSW 19 46065342 missense unknown
Predicted Primers PCR Primer
(F):5'- CACATTCAGTTGGGAGTGGG -3'
(R):5'- ACAGTGTCTGGTGGTAACAG -3'

Sequencing Primer
(F):5'- CACATTCAGTTGGGAGTGGGTATTTC -3'
(R):5'- TGGGGGAAGACACTAGAGTC -3'
Posted On2015-08-18