Incidental Mutation 'R4551:Pdk3'
ID333987
Institutional Source Beutler Lab
Gene Symbol Pdk3
Ensembl Gene ENSMUSG00000035232
Gene Namepyruvate dehydrogenase kinase, isoenzyme 3
Synonyms
MMRRC Submission 041782-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R4551 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location93764607-93832201 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93782240 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 253 (M253K)
Ref Sequence ENSEMBL: ENSMUSP00000036604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045748]
Predicted Effect probably damaging
Transcript: ENSMUST00000045748
AA Change: M253K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000036604
Gene: ENSMUSG00000035232
AA Change: M253K

DomainStartEndE-ValueType
Pfam:BCDHK_Adom3 26 188 3.8e-50 PFAM
HATPase_c 236 362 3.32e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134502
Meta Mutation Damage Score 0.9613 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The pyruvate dehydrogenase (PDH) complex is a nuclear-encoded mitochondrial multienzyme complex that catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2). It provides the primary link between glycolysis and the tricarboxylic acid (TCA) cycle, and thus is one of the major enzymes responsible for the regulation of glucose metabolism. The enzymatic activity of PDH is regulated by a phosphorylation/dephosphorylation cycle, and phosphorylation results in inactivation of PDH. The protein encoded by this gene is one of the three pyruvate dehydrogenase kinases that inhibits the PDH complex by phosphorylation of the E1 alpha subunit. This gene is predominantly expressed in the heart and skeletal muscles. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk T G 11: 120,011,569 E610A probably benign Het
Abhd17b T C 19: 21,680,926 S176P possibly damaging Het
Adgrg7 A G 16: 56,748,012 Y427H probably damaging Het
Alox15 T A 11: 70,344,596 I647L probably benign Het
Ankhd1 C A 18: 36,655,507 probably null Het
Arid1a A C 4: 133,695,699 probably benign Het
Armcx5 T A X: 135,746,507 V444D probably damaging Het
C4bp A G 1: 130,636,727 Y407H possibly damaging Het
Cog6 T A 3: 52,998,320 E96V probably damaging Het
Cox20 A C 1: 178,322,549 N96T probably benign Het
Cpa3 T C 3: 20,219,770 I351V probably benign Het
Cpd C T 11: 76,811,886 G552D probably damaging Het
Cyld A G 8: 88,707,134 K184E possibly damaging Het
Dab2 G A 15: 6,435,294 G324D probably damaging Het
Depdc1a T A 3: 159,522,584 D324E probably damaging Het
Dnah9 T C 11: 65,841,366 E4238G probably damaging Het
Dync1i1 T A 6: 5,923,206 D275E probably benign Het
Epgn A T 5: 91,027,562 K14* probably null Het
Farp2 T A 1: 93,618,592 L868Q possibly damaging Het
Gpr45 A G 1: 43,032,790 T198A probably benign Het
Grk2 C T 19: 4,286,056 V402M possibly damaging Het
Gsap A T 5: 21,290,571 D79V probably damaging Het
Gtf2h3 A G 5: 124,590,419 probably benign Het
Hus1b C A 13: 30,947,076 S200I probably damaging Het
Hypk A G 2: 121,453,480 probably null Het
Ikbke T C 1: 131,258,033 probably benign Het
Kat6b A G 14: 21,661,448 E670G probably damaging Het
Kif26b T A 1: 178,884,035 I740N probably damaging Het
Lhx3 G A 2: 26,201,190 P369L probably damaging Het
Man2c1 T C 9: 57,131,161 L35P probably damaging Het
Micalcl T A 7: 112,381,916 S366T possibly damaging Het
Mroh9 A T 1: 163,044,093 I607N probably damaging Het
Mybphl T C 3: 108,374,163 I65T possibly damaging Het
Myo1g A G 11: 6,517,874 I187T probably damaging Het
Myo7b T C 18: 31,985,108 S822G probably benign Het
Nkx2-4 C A 2: 147,084,922 A142S probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Odf4 C T 11: 68,922,040 S264N probably benign Het
Olfr360 G T 2: 37,068,343 V13L probably benign Het
Olfr45 A T 7: 140,691,742 Y279F probably damaging Het
Olfr657 A T 7: 104,636,424 H250L probably damaging Het
Papolb T C 5: 142,529,178 I237V probably benign Het
Parpbp T A 10: 88,093,702 Q428L possibly damaging Het
Pcdhb16 T C 18: 37,479,834 F616L probably damaging Het
Pgap2 C A 7: 102,226,467 probably benign Het
Pkhd1l1 C A 15: 44,550,885 N2849K probably damaging Het
Pprc1 A G 19: 46,067,225 probably benign Het
Psma2 A G 13: 14,616,845 Y25C possibly damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptpn5 C A 7: 47,090,852 probably benign Het
Pxn G T 5: 115,552,720 probably benign Het
Scd3 C A 19: 44,215,439 A22E probably benign Het
Sdr42e1 T C 8: 117,663,608 E98G probably benign Het
Slc14a2 A C 18: 78,195,853 S184A probably benign Het
Tmem236 A T 2: 14,219,153 Q251L probably benign Het
Trappc8 T C 18: 20,874,672 T129A probably benign Het
Vmn1r90 A C 7: 14,561,969 M68R possibly damaging Het
Vmn2r105 A G 17: 20,226,351 V462A probably benign Het
Vmn2r7 T C 3: 64,690,689 T816A possibly damaging Het
Vmn2r81 T A 10: 79,268,407 I288K possibly damaging Het
Zfp180 A C 7: 24,104,573 K139T possibly damaging Het
Zfp932 T C 5: 110,009,639 V401A probably benign Het
Other mutations in Pdk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03058:Pdk3 APN X 93802286 missense probably benign 0.38
IGL03296:Pdk3 APN X 93831897 missense probably damaging 1.00
R2231:Pdk3 UTSW X 93813998 missense probably damaging 1.00
R2232:Pdk3 UTSW X 93813998 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCAAGAACTGCCAGGTCC -3'
(R):5'- GATAGCCAAGCTCAGTGGAG -3'

Sequencing Primer
(F):5'- AAGAACTGCCAGGTCCCTTGC -3'
(R):5'- ATAAAAGTAATCTTGTGCTTGTTTCG -3'
Posted On2015-08-18