Incidental Mutation 'R4552:Dner'
ID333991
Institutional Source Beutler Lab
Gene Symbol Dner
Ensembl Gene ENSMUSG00000036766
Gene Namedelta/notch-like EGF repeat containing
SynonymsA930026D19Rik, BET
MMRRC Submission 041783-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4552 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location84369839-84696221 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84383857 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 677 (Y677C)
Ref Sequence ENSEMBL: ENSMUSP00000042927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049126]
Predicted Effect probably damaging
Transcript: ENSMUST00000049126
AA Change: Y677C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042927
Gene: ENSMUSG00000036766
AA Change: Y677C

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
EGF 47 92 9.85e-5 SMART
EGF 97 133 2.33e-6 SMART
EGF 306 348 1.8e1 SMART
EGF 352 390 5e-6 SMART
EGF_CA 392 428 8.97e-8 SMART
EGF 433 466 3.54e-6 SMART
EGF 471 503 4.66e-6 SMART
EGF_CA 505 541 1.61e-9 SMART
EGF 546 579 9.7e-4 SMART
EGF_CA 581 617 4.52e-13 SMART
transmembrane domain 639 661 N/A INTRINSIC
Meta Mutation Damage Score 0.3611 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 97% (62/64)
MGI Phenotype PHENOTYPE: Homozygous null mice display delayed cerebellar development, abnormal Bergmann glial cells, abnormal Purkinje cell innervation, and impaired coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Arhgap33 A T 7: 30,519,108 probably benign Het
Arid1a A C 4: 133,695,699 probably benign Het
C4bp A G 1: 130,636,727 Y407H possibly damaging Het
Camta1 T C 4: 151,792,502 R79G probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Cep128 T C 12: 91,294,162 E309G probably damaging Het
Chit1 A G 1: 134,144,051 T100A probably benign Het
Dalrd3 A G 9: 108,572,230 D454G possibly damaging Het
Ddx19a G A 8: 110,978,566 Q308* probably null Het
Dmxl2 T C 9: 54,451,763 N395S probably damaging Het
Dnah17 T C 11: 118,052,943 D3125G possibly damaging Het
Dnah5 T C 15: 28,397,154 V3331A probably benign Het
Dnah9 T C 11: 65,841,366 E4238G probably damaging Het
Epgn A T 5: 91,027,562 K14* probably null Het
Hid1 G A 11: 115,358,679 T240M possibly damaging Het
Igbp1b T A 6: 138,658,114 M111L probably benign Het
Kif26b T A 1: 178,884,035 I740N probably damaging Het
Klk4 C A 7: 43,884,019 H101N probably benign Het
Mrgpra2b C A 7: 47,464,006 S300I probably benign Het
Mtss1l A G 8: 110,738,505 T464A probably damaging Het
Nbas T C 12: 13,335,937 probably null Het
Nif3l1 C T 1: 58,449,324 probably benign Het
Noct T A 3: 51,250,168 I309N probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Odf2l A T 3: 145,151,083 T600S probably benign Het
Odf4 C T 11: 68,922,040 S264N probably benign Het
Olfr1391 A T 11: 49,327,950 M180L probably benign Het
Olfr24 A G 9: 18,755,134 V167A possibly damaging Het
Olfr45 A T 7: 140,691,742 Y279F probably damaging Het
Olfr815 T C 10: 129,902,123 M196V probably benign Het
Papolb T C 5: 142,529,178 I237V probably benign Het
Parpbp T A 10: 88,093,702 Q428L possibly damaging Het
Pclo T C 5: 14,669,271 S1141P unknown Het
Plcb1 T C 2: 135,335,493 S582P probably benign Het
Ppargc1a C T 5: 51,463,215 probably benign Het
Ptchd4 A T 17: 42,502,455 I416L probably benign Het
Rhpn1 G A 15: 75,714,119 R627H probably benign Het
Ric8a G A 7: 140,861,337 G182S probably damaging Het
Rims1 T C 1: 22,373,494 D895G probably damaging Het
Rrp1b G A 17: 32,056,010 probably benign Het
Rtf1 T A 2: 119,730,729 D636E probably benign Het
Scn3a T C 2: 65,524,179 D333G probably benign Het
Sema6a A G 18: 47,291,923 L207P probably damaging Het
Shcbp1 A T 8: 4,749,779 Y160* probably null Het
Slc27a1 A T 8: 71,580,066 probably null Het
Ston2 C T 12: 91,641,872 R818Q probably damaging Het
Tipin T A 9: 64,288,103 probably null Het
Tjap1 A T 17: 46,260,027 probably null Het
Vmn1r117 A T 7: 20,883,592 F177Y probably damaging Het
Vmn1r57 A G 7: 5,220,668 D64G possibly damaging Het
Vmn2r73 T A 7: 85,875,847 D31V probably benign Het
Vmn2r-ps41 A T 7: 9,177,064 noncoding transcript Het
Other mutations in Dner
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01434:Dner APN 1 84384010 missense probably benign 0.13
IGL02251:Dner APN 1 84384026 missense probably damaging 1.00
IGL02904:Dner APN 1 84534944 missense probably damaging 0.96
IGL03063:Dner APN 1 84585338 missense possibly damaging 0.90
R0013:Dner UTSW 1 84494893 splice site probably benign
R0112:Dner UTSW 1 84583053 missense probably benign 0.06
R0196:Dner UTSW 1 84370832 missense probably damaging 1.00
R0282:Dner UTSW 1 84405965 missense probably damaging 1.00
R0282:Dner UTSW 1 84445380 splice site probably benign
R0942:Dner UTSW 1 84585309 splice site probably benign
R1143:Dner UTSW 1 84445464 missense probably damaging 1.00
R1483:Dner UTSW 1 84585549 utr 5 prime probably benign
R1585:Dner UTSW 1 84585456 missense probably benign 0.05
R1636:Dner UTSW 1 84585330 missense possibly damaging 0.89
R1739:Dner UTSW 1 84370784 missense probably damaging 0.99
R1756:Dner UTSW 1 84445590 missense probably damaging 0.98
R1960:Dner UTSW 1 84445456 missense probably damaging 0.98
R2061:Dner UTSW 1 84405989 missense probably damaging 1.00
R2157:Dner UTSW 1 84383938 missense possibly damaging 0.88
R2265:Dner UTSW 1 84585549 utr 5 prime probably benign
R2382:Dner UTSW 1 84370823 missense probably damaging 1.00
R2507:Dner UTSW 1 84583080 missense probably damaging 1.00
R3053:Dner UTSW 1 84384026 missense probably damaging 1.00
R3917:Dner UTSW 1 84585549 utr 5 prime probably benign
R4530:Dner UTSW 1 84583015 missense probably damaging 1.00
R4579:Dner UTSW 1 84383816 missense probably damaging 0.97
R4593:Dner UTSW 1 84695728 start codon destroyed probably null
R4711:Dner UTSW 1 84383897 missense possibly damaging 0.75
R5102:Dner UTSW 1 84405970 missense probably damaging 1.00
R5314:Dner UTSW 1 84580739 missense probably damaging 1.00
R5370:Dner UTSW 1 84585549 utr 5 prime probably benign
R6000:Dner UTSW 1 84383929 missense possibly damaging 0.80
R6644:Dner UTSW 1 84395707 missense probably damaging 1.00
R6764:Dner UTSW 1 84494781 missense probably damaging 1.00
R6948:Dner UTSW 1 84406017 missense probably damaging 1.00
R6991:Dner UTSW 1 84476402 nonsense probably null
R7056:Dner UTSW 1 84580736 missense possibly damaging 0.75
R7410:Dner UTSW 1 84585611 missense probably damaging 1.00
R7490:Dner UTSW 1 84585549 utr 5 prime probably benign
R7869:Dner UTSW 1 84383881 missense probably benign 0.10
R7952:Dner UTSW 1 84383881 missense probably benign 0.10
Z1176:Dner UTSW 1 84383980 missense possibly damaging 0.88
Z1177:Dner UTSW 1 84405989 missense probably damaging 1.00
Z1177:Dner UTSW 1 84445430 missense probably damaging 1.00
Z1177:Dner UTSW 1 84445433 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCTAGTACTCTGTCTTCAGTGC -3'
(R):5'- AGTGGAAGTCTGGGCACATG -3'

Sequencing Primer
(F):5'- CAGTGCCTTGTTCAGCAGG -3'
(R):5'- ATCATCCTGATTGTGGGC -3'
Posted On2015-08-18