Incidental Mutation 'R4552:C4bp'
ID333992
Institutional Source Beutler Lab
Gene Symbol C4bp
Ensembl Gene ENSMUSG00000026405
Gene Namecomplement component 4 binding protein
Synonyms
MMRRC Submission 041783-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4552 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location130634773-130661632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130636727 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 407 (Y407H)
Ref Sequence ENSEMBL: ENSMUSP00000027657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027657]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027657
AA Change: Y407H

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027657
Gene: ENSMUSG00000026405
AA Change: Y407H

DomainStartEndE-ValueType
CCP 58 115 3.45e-5 SMART
CCP 120 176 3.17e-13 SMART
CCP 181 240 4.59e-10 SMART
CCP 245 299 3.12e-12 SMART
CCP 303 355 7.28e-13 SMART
CCP 359 413 1.07e-10 SMART
PDB:4B0F|G 416 459 6e-9 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000171642
SMART Domains Protein: ENSMUSP00000130533
Gene: ENSMUSG00000026405

DomainStartEndE-ValueType
CCP 16 75 4.59e-10 SMART
CCP 80 124 1.38e0 SMART
CCP 125 177 7.28e-13 SMART
Meta Mutation Damage Score 0.1407 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 97% (62/64)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Arhgap33 A T 7: 30,519,108 probably benign Het
Arid1a A C 4: 133,695,699 probably benign Het
Camta1 T C 4: 151,792,502 R79G probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Cep128 T C 12: 91,294,162 E309G probably damaging Het
Chit1 A G 1: 134,144,051 T100A probably benign Het
Dalrd3 A G 9: 108,572,230 D454G possibly damaging Het
Ddx19a G A 8: 110,978,566 Q308* probably null Het
Dmxl2 T C 9: 54,451,763 N395S probably damaging Het
Dnah17 T C 11: 118,052,943 D3125G possibly damaging Het
Dnah5 T C 15: 28,397,154 V3331A probably benign Het
Dnah9 T C 11: 65,841,366 E4238G probably damaging Het
Dner T C 1: 84,383,857 Y677C probably damaging Het
Epgn A T 5: 91,027,562 K14* probably null Het
Hid1 G A 11: 115,358,679 T240M possibly damaging Het
Igbp1b T A 6: 138,658,114 M111L probably benign Het
Kif26b T A 1: 178,884,035 I740N probably damaging Het
Klk4 C A 7: 43,884,019 H101N probably benign Het
Mrgpra2b C A 7: 47,464,006 S300I probably benign Het
Mtss1l A G 8: 110,738,505 T464A probably damaging Het
Nbas T C 12: 13,335,937 probably null Het
Nif3l1 C T 1: 58,449,324 probably benign Het
Noct T A 3: 51,250,168 I309N probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Odf2l A T 3: 145,151,083 T600S probably benign Het
Odf4 C T 11: 68,922,040 S264N probably benign Het
Olfr1391 A T 11: 49,327,950 M180L probably benign Het
Olfr24 A G 9: 18,755,134 V167A possibly damaging Het
Olfr45 A T 7: 140,691,742 Y279F probably damaging Het
Olfr815 T C 10: 129,902,123 M196V probably benign Het
Papolb T C 5: 142,529,178 I237V probably benign Het
Parpbp T A 10: 88,093,702 Q428L possibly damaging Het
Pclo T C 5: 14,669,271 S1141P unknown Het
Plcb1 T C 2: 135,335,493 S582P probably benign Het
Ppargc1a C T 5: 51,463,215 probably benign Het
Ptchd4 A T 17: 42,502,455 I416L probably benign Het
Rhpn1 G A 15: 75,714,119 R627H probably benign Het
Ric8a G A 7: 140,861,337 G182S probably damaging Het
Rims1 T C 1: 22,373,494 D895G probably damaging Het
Rrp1b G A 17: 32,056,010 probably benign Het
Rtf1 T A 2: 119,730,729 D636E probably benign Het
Scn3a T C 2: 65,524,179 D333G probably benign Het
Sema6a A G 18: 47,291,923 L207P probably damaging Het
Shcbp1 A T 8: 4,749,779 Y160* probably null Het
Slc27a1 A T 8: 71,580,066 probably null Het
Ston2 C T 12: 91,641,872 R818Q probably damaging Het
Tipin T A 9: 64,288,103 probably null Het
Tjap1 A T 17: 46,260,027 probably null Het
Vmn1r117 A T 7: 20,883,592 F177Y probably damaging Het
Vmn1r57 A G 7: 5,220,668 D64G possibly damaging Het
Vmn2r73 T A 7: 85,875,847 D31V probably benign Het
Vmn2r-ps41 A T 7: 9,177,064 noncoding transcript Het
Other mutations in C4bp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:C4bp APN 1 130639134 missense probably damaging 1.00
IGL01349:C4bp APN 1 130642928 intron probably benign
IGL01401:C4bp APN 1 130648064 missense possibly damaging 0.95
IGL02252:C4bp APN 1 130636787 missense probably damaging 1.00
IGL02903:C4bp APN 1 130655985 missense probably damaging 1.00
IGL02958:C4bp APN 1 130636795 missense probably damaging 1.00
IGL03061:C4bp APN 1 130636717 missense probably damaging 0.98
PIT4434001:C4bp UTSW 1 130657210 missense probably benign 0.14
R0989:C4bp UTSW 1 130643053 missense probably benign 0.02
R1728:C4bp UTSW 1 130642988 missense probably benign 0.04
R1729:C4bp UTSW 1 130642988 missense probably benign 0.04
R1730:C4bp UTSW 1 130642988 missense probably benign 0.04
R1739:C4bp UTSW 1 130642988 missense probably benign 0.04
R1762:C4bp UTSW 1 130642988 missense probably benign 0.04
R1783:C4bp UTSW 1 130642988 missense probably benign 0.04
R1784:C4bp UTSW 1 130642988 missense probably benign 0.04
R1785:C4bp UTSW 1 130642988 missense probably benign 0.04
R1942:C4bp UTSW 1 130656067 splice site probably benign
R2006:C4bp UTSW 1 130648032 nonsense probably null
R3877:C4bp UTSW 1 130648027 critical splice donor site probably null
R4446:C4bp UTSW 1 130642955 missense probably benign 0.06
R4551:C4bp UTSW 1 130636727 missense possibly damaging 0.46
R4727:C4bp UTSW 1 130639185 missense probably benign 0.19
R4761:C4bp UTSW 1 130653421 missense possibly damaging 0.83
R5620:C4bp UTSW 1 130653353 missense probably damaging 1.00
R6110:C4bp UTSW 1 130639072 nonsense probably null
R6189:C4bp UTSW 1 130636819 missense probably damaging 1.00
R6344:C4bp UTSW 1 130656015 missense probably benign 0.12
R6418:C4bp UTSW 1 130656013 missense probably damaging 1.00
R6895:C4bp UTSW 1 130636206 makesense probably null
R6964:C4bp UTSW 1 130657272 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GTTCTATGCCAACTCCCCAAATG -3'
(R):5'- GCATACACTGTCACAAATGTTCAAC -3'

Sequencing Primer
(F):5'- TATGCCAACTCCCCAAATGACATG -3'
(R):5'- AGCTACTTCAAGTTCAGTTCATTC -3'
Posted On2015-08-18