Mutagenetix > Incidental Mutations

Incidental Mutation 'R4552:Plcb1'

333997

Institutional Source

Beutler Lab

Gene Symbol

Plcb1

Ensembl Gene

ENSMUSG00000051177

Gene Name

phospholipase C, beta 1

Synonyms

3110043I21Rik

MMRRC Submission

041783-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.228) question?

Stock #

R4552 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

134786067-135475258 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 135335493 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 582 (S582P)

Ref Sequence

ENSEMBL: ENSMUSP00000118756 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070724] [ENSMUST00000110116] [ENSMUST00000131552]

Predicted Effect

probably benign
Transcript: ENSMUST00000070724
AA Change: S582P

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000064844
Gene: ENSMUSG00000051177
AA Change: S582P

Domain	Start	End	E-Value	Type
Pfam:EF-hand_like	224	315	2.2e-26	PFAM
PLCXc	316	467	2.85e-74	SMART
low complexity region	491	501	N/A	INTRINSIC
PLCYc	540	656	2e-69	SMART
C2	677	776	1.55e-12	SMART
low complexity region	871	885	N/A	INTRINSIC
Pfam:DUF1154	903	946	1.3e-7	PFAM
low complexity region	967	984	N/A	INTRINSIC
Pfam:PLC-beta_C	997	1155	1.9e-64	PFAM
low complexity region	1157	1168	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110116
AA Change: S582P

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000105743
Gene: ENSMUSG00000051177
AA Change: S582P

Domain	Start	End	E-Value	Type
Pfam:EF-hand_like	224	315	4.1e-26	PFAM
PLCXc	316	467	2.85e-74	SMART
low complexity region	491	501	N/A	INTRINSIC
PLCYc	540	656	2e-69	SMART
C2	677	776	1.55e-12	SMART
low complexity region	871	885	N/A	INTRINSIC
Pfam:DUF1154	903	946	1.1e-9	PFAM
low complexity region	967	984	N/A	INTRINSIC
Pfam:PLC-beta_C	1003	1176	2.9e-61	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000131552
AA Change: S582P

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000118756
Gene: ENSMUSG00000051177
AA Change: S582P

Domain	Start	End	E-Value	Type
Pfam:EF-hand_like	224	315	3.9e-26	PFAM
PLCXc	316	467	2.85e-74	SMART
low complexity region	491	501	N/A	INTRINSIC
PLCYc	540	656	2e-69	SMART
C2	677	776	1.55e-12	SMART
low complexity region	871	885	N/A	INTRINSIC
Pfam:DUF1154	903	946	1e-9	PFAM
low complexity region	967	984	N/A	INTRINSIC
Pfam:PLC-beta_C	1003	1148	8e-51	PFAM
low complexity region	1157	1168	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153402

Meta Mutation Damage Score

0.2152

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.4%

Validation Efficiency

97% (62/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of many extracellular signals. This gene is activated by two G-protein alpha subunits, alpha-q and alpha-11. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit spontaneous seizures and high mortality around 3 weeks of age. Mutant males show exhibit sperm with a reduced acrosome reaction rate and fertilizing capacity in vitro and decreased fertility in vivo. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts16	G	A	13: 70,779,518		probably benign	Het
Arhgap33	A	T	7: 30,519,108		probably benign	Het
Arid1a	A	C	4: 133,695,699		probably benign	Het
C4bp	A	G	1: 130,636,727	Y407H	possibly damaging	Het
Camta1	T	C	4: 151,792,502	R79G	probably damaging	Het
Caskin1	G	A	17: 24,506,628	S1296N	probably benign	Het
Cep128	T	C	12: 91,294,162	E309G	probably damaging	Het
Chit1	A	G	1: 134,144,051	T100A	probably benign	Het
Dalrd3	A	G	9: 108,572,230	D454G	possibly damaging	Het
Ddx19a	G	A	8: 110,978,566	Q308*	probably null	Het
Dmxl2	T	C	9: 54,451,763	N395S	probably damaging	Het
Dnah17	T	C	11: 118,052,943	D3125G	possibly damaging	Het
Dnah5	T	C	15: 28,397,154	V3331A	probably benign	Het
Dnah9	T	C	11: 65,841,366	E4238G	probably damaging	Het
Dner	T	C	1: 84,383,857	Y677C	probably damaging	Het
Epgn	A	T	5: 91,027,562	K14*	probably null	Het
Hid1	G	A	11: 115,358,679	T240M	possibly damaging	Het
Igbp1b	T	A	6: 138,658,114	M111L	probably benign	Het
Kif26b	T	A	1: 178,884,035	I740N	probably damaging	Het
Klk4	C	A	7: 43,884,019	H101N	probably benign	Het
Mrgpra2b	C	A	7: 47,464,006	S300I	probably benign	Het
Mtss1l	A	G	8: 110,738,505	T464A	probably damaging	Het
Nbas	T	C	12: 13,335,937		probably null	Het
Nif3l1	C	T	1: 58,449,324		probably benign	Het
Noct	T	A	3: 51,250,168	I309N	probably benign	Het
Obscn	T	C	11: 59,131,646	R758G	possibly damaging	Het
Odf2l	A	T	3: 145,151,083	T600S	probably benign	Het
Odf4	C	T	11: 68,922,040	S264N	probably benign	Het
Olfr1391	A	T	11: 49,327,950	M180L	probably benign	Het
Olfr24	A	G	9: 18,755,134	V167A	possibly damaging	Het
Olfr45	A	T	7: 140,691,742	Y279F	probably damaging	Het
Olfr815	T	C	10: 129,902,123	M196V	probably benign	Het
Papolb	T	C	5: 142,529,178	I237V	probably benign	Het
Parpbp	T	A	10: 88,093,702	Q428L	possibly damaging	Het
Pclo	T	C	5: 14,669,271	S1141P	unknown	Het
Ppargc1a	C	T	5: 51,463,215		probably benign	Het
Ptchd4	A	T	17: 42,502,455	I416L	probably benign	Het
Rhpn1	G	A	15: 75,714,119	R627H	probably benign	Het
Ric8a	G	A	7: 140,861,337	G182S	probably damaging	Het
Rims1	T	C	1: 22,373,494	D895G	probably damaging	Het
Rrp1b	G	A	17: 32,056,010		probably benign	Het
Rtf1	T	A	2: 119,730,729	D636E	probably benign	Het
Scn3a	T	C	2: 65,524,179	D333G	probably benign	Het
Sema6a	A	G	18: 47,291,923	L207P	probably damaging	Het
Shcbp1	A	T	8: 4,749,779	Y160*	probably null	Het
Slc27a1	A	T	8: 71,580,066		probably null	Het
Ston2	C	T	12: 91,641,872	R818Q	probably damaging	Het
Tipin	T	A	9: 64,288,103		probably null	Het
Tjap1	A	T	17: 46,260,027		probably null	Het
Vmn1r117	A	T	7: 20,883,592	F177Y	probably damaging	Het
Vmn1r57	A	G	7: 5,220,668	D64G	possibly damaging	Het
Vmn2r73	T	A	7: 85,875,847	D31V	probably benign	Het
Vmn2r-ps41	A	T	7: 9,177,064		noncoding transcript	Het

Other mutations in Plcb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00510:Plcb1	APN	2	135251756	missense	possibly damaging	0.66
IGL01152:Plcb1	APN	2	134813659	missense	probably damaging	1.00
IGL01945:Plcb1	APN	2	135220791	missense	probably benign	0.03
IGL01999:Plcb1	APN	2	135346318	missense	probably damaging	1.00
IGL02109:Plcb1	APN	2	134786559	missense	probably damaging	1.00
IGL02153:Plcb1	APN	2	135387853	missense	probably benign	0.08
IGL02207:Plcb1	APN	2	135387171	missense	probably damaging	1.00
IGL02566:Plcb1	APN	2	135472263	missense	probably benign	0.17
IGL02590:Plcb1	APN	2	135294864	missense	probably benign	0.08
IGL02640:Plcb1	APN	2	135220859	splice site	probably benign
IGL02926:Plcb1	APN	2	135364762	splice site	probably benign
IGL03071:Plcb1	APN	2	135387802	missense	probably damaging	1.00
IGL03236:Plcb1	APN	2	135346306	missense	probably damaging	1.00
IGL03252:Plcb1	APN	2	135370428	missense	probably benign
IGL03387:Plcb1	APN	2	134813686	splice site	probably benign
R0024:Plcb1	UTSW	2	135362425	missense	probably benign	0.06
R0024:Plcb1	UTSW	2	135362425	missense	probably benign	0.06
R0053:Plcb1	UTSW	2	135294915	missense	probably benign	0.33
R0053:Plcb1	UTSW	2	135294915	missense	probably benign	0.33
R0308:Plcb1	UTSW	2	134813614	missense	probably benign	0.01
R0415:Plcb1	UTSW	2	135337499	missense	probably damaging	1.00
R0624:Plcb1	UTSW	2	135294911	missense	possibly damaging	0.81
R0898:Plcb1	UTSW	2	135387143	missense	possibly damaging	0.73
R1071:Plcb1	UTSW	2	135325657	missense	possibly damaging	0.64
R1615:Plcb1	UTSW	2	135362444	splice site	probably benign
R1617:Plcb1	UTSW	2	135337441	missense	probably damaging	1.00
R1785:Plcb1	UTSW	2	135325667	nonsense	probably null
R1866:Plcb1	UTSW	2	135344173	missense	probably benign	0.01
R1869:Plcb1	UTSW	2	135311014	missense	probably benign	0.02
R1902:Plcb1	UTSW	2	134813613	missense	possibly damaging	0.93
R1938:Plcb1	UTSW	2	135386302	missense	probably damaging	1.00
R2016:Plcb1	UTSW	2	135362420	missense	possibly damaging	0.94
R2017:Plcb1	UTSW	2	135362420	missense	possibly damaging	0.94
R2131:Plcb1	UTSW	2	135325667	nonsense	probably null
R2132:Plcb1	UTSW	2	135325667	nonsense	probably null
R2133:Plcb1	UTSW	2	135325667	nonsense	probably null
R2164:Plcb1	UTSW	2	135346330	missense	possibly damaging	0.87
R2419:Plcb1	UTSW	2	135262100	splice site	probably benign
R2429:Plcb1	UTSW	2	135337442	missense	probably damaging	0.99
R2508:Plcb1	UTSW	2	135260508	missense	probably benign	0.27
R3161:Plcb1	UTSW	2	135335482	missense	probably benign	0.03
R3870:Plcb1	UTSW	2	135325671	missense	probably damaging	0.99
R4191:Plcb1	UTSW	2	135345090	missense	probably damaging	1.00
R4239:Plcb1	UTSW	2	135344158	missense	probably damaging	0.99
R4553:Plcb1	UTSW	2	135335493	missense	probably benign	0.44
R4720:Plcb1	UTSW	2	135251747	missense	possibly damaging	0.70
R4946:Plcb1	UTSW	2	135345095	missense	probably benign	0.01
R5012:Plcb1	UTSW	2	135333400	missense	probably null	0.97
R5151:Plcb1	UTSW	2	135262245	missense	probably benign	0.28
R5320:Plcb1	UTSW	2	135252776	missense	possibly damaging	0.56
R5415:Plcb1	UTSW	2	135347402	missense	possibly damaging	0.67
R5523:Plcb1	UTSW	2	135260566	missense	probably benign	0.08
R5568:Plcb1	UTSW	2	135370593	missense	probably damaging	1.00
R5688:Plcb1	UTSW	2	135335480	missense	probably benign	0.06
R5809:Plcb1	UTSW	2	135262244	missense	possibly damaging	0.83
R6237:Plcb1	UTSW	2	135370566	missense	possibly damaging	0.94
R6315:Plcb1	UTSW	2	135346341	missense	probably benign	0.00
R6478:Plcb1	UTSW	2	135335451	missense	probably damaging	1.00
R6531:Plcb1	UTSW	2	135325802	critical splice donor site	probably null
R6683:Plcb1	UTSW	2	134786593	missense	probably benign	0.32
R6760:Plcb1	UTSW	2	135472060	missense	possibly damaging	0.50
R6947:Plcb1	UTSW	2	135386155	missense	probably benign	0.08
R6976:Plcb1	UTSW	2	135262239	missense	possibly damaging	0.75
R7379:Plcb1	UTSW	2	135370510	missense	probably benign	0.45
R7473:Plcb1	UTSW	2	135344276	missense	probably damaging	0.98
R7492:Plcb1	UTSW	2	135251764	nonsense	probably null
R7498:Plcb1	UTSW	2	135262233	nonsense	probably null
R7498:Plcb1	UTSW	2	135262234	missense	probably damaging	0.99
R7777:Plcb1	UTSW	2	135220757	missense	possibly damaging	0.51
R8061:Plcb1	UTSW	2	135346396	missense	probably benign
S24628:Plcb1	UTSW	2	135337499	missense	probably damaging	1.00
X0025:Plcb1	UTSW	2	135345054	missense	possibly damaging	0.87
Z1088:Plcb1	UTSW	2	135220846	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- ATGCAGTTCCTACCTTCTAAGTCAC -3'
(R):5'- AACTCAGAGGTTGATGGCTTGAG -3'

Sequencing Primer
(F):5'- AGTTCCTACCTTCTAAGTCACTGAAC -3'
(R):5'- GGACCTCTGCTATCCTAAAGC -3'

Posted On

2015-08-18