Incidental Mutation 'R4552:Noct'
ID333998
Institutional Source Beutler Lab
Gene Symbol Noct
Ensembl Gene ENSMUSG00000023087
Gene Namenocturnin
SynonymsCcrn4l, Ccr4
MMRRC Submission 041783-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R4552 (G1)
Quality Score188
Status Validated
Chromosome3
Chromosomal Location51224447-51251644 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 51250168 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 309 (I309N)
Ref Sequence ENSEMBL: ENSMUSP00000130347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023849] [ENSMUST00000144826] [ENSMUST00000167780] [ENSMUST00000193018] [ENSMUST00000194641]
Predicted Effect probably benign
Transcript: ENSMUST00000023849
AA Change: I309N

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000023849
Gene: ENSMUSG00000023087
AA Change: I309N

DomainStartEndE-ValueType
low complexity region 48 58 N/A INTRINSIC
Pfam:Exo_endo_phos 144 412 3.6e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144826
AA Change: I245N

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000141416
Gene: ENSMUSG00000023087
AA Change: I245N

DomainStartEndE-ValueType
Pfam:Exo_endo_phos 80 348 6.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167780
AA Change: I309N

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000130347
Gene: ENSMUSG00000023087
AA Change: I309N

DomainStartEndE-ValueType
low complexity region 48 58 N/A INTRINSIC
Pfam:Exo_endo_phos 144 412 5.7e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193018
SMART Domains Protein: ENSMUSP00000142216
Gene: ENSMUSG00000023087

DomainStartEndE-ValueType
SCOP:d1hd7a_ 52 84 4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194641
SMART Domains Protein: ENSMUSP00000141197
Gene: ENSMUSG00000037174

DomainStartEndE-ValueType
Pfam:Elf-1_N 2 108 1.2e-37 PFAM
low complexity region 142 154 N/A INTRINSIC
low complexity region 172 181 N/A INTRINSIC
ETS 207 294 1.28e-51 SMART
low complexity region 369 391 N/A INTRINSIC
low complexity region 423 433 N/A INTRINSIC
Meta Mutation Damage Score 0.1143 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to Nocturnin, a gene identified as a circadian clock regulated gene in Xenopus laevis. This protein and Nocturnin protein share similarity with the C-terminal domain of a yeast transcription factor, carbon catabolite repression 4 (CCR4). The mRNA abundance of a similar gene in mouse has been shown to exhibit circadian rhythmicity, which suggests a role for this protein in clock function or as a circadian clock effector. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele are resistant to diet-induced obesity and fatty liver development, show increased circulating glucose levels and increased insulin sensitivity on a standard diet and have impaired glucose tolerance on a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Arhgap33 A T 7: 30,519,108 probably benign Het
Arid1a A C 4: 133,695,699 probably benign Het
C4bp A G 1: 130,636,727 Y407H possibly damaging Het
Camta1 T C 4: 151,792,502 R79G probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Cep128 T C 12: 91,294,162 E309G probably damaging Het
Chit1 A G 1: 134,144,051 T100A probably benign Het
Dalrd3 A G 9: 108,572,230 D454G possibly damaging Het
Ddx19a G A 8: 110,978,566 Q308* probably null Het
Dmxl2 T C 9: 54,451,763 N395S probably damaging Het
Dnah17 T C 11: 118,052,943 D3125G possibly damaging Het
Dnah5 T C 15: 28,397,154 V3331A probably benign Het
Dnah9 T C 11: 65,841,366 E4238G probably damaging Het
Dner T C 1: 84,383,857 Y677C probably damaging Het
Epgn A T 5: 91,027,562 K14* probably null Het
Hid1 G A 11: 115,358,679 T240M possibly damaging Het
Igbp1b T A 6: 138,658,114 M111L probably benign Het
Kif26b T A 1: 178,884,035 I740N probably damaging Het
Klk4 C A 7: 43,884,019 H101N probably benign Het
Mrgpra2b C A 7: 47,464,006 S300I probably benign Het
Mtss1l A G 8: 110,738,505 T464A probably damaging Het
Nbas T C 12: 13,335,937 probably null Het
Nif3l1 C T 1: 58,449,324 probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Odf2l A T 3: 145,151,083 T600S probably benign Het
Odf4 C T 11: 68,922,040 S264N probably benign Het
Olfr1391 A T 11: 49,327,950 M180L probably benign Het
Olfr24 A G 9: 18,755,134 V167A possibly damaging Het
Olfr45 A T 7: 140,691,742 Y279F probably damaging Het
Olfr815 T C 10: 129,902,123 M196V probably benign Het
Papolb T C 5: 142,529,178 I237V probably benign Het
Parpbp T A 10: 88,093,702 Q428L possibly damaging Het
Pclo T C 5: 14,669,271 S1141P unknown Het
Plcb1 T C 2: 135,335,493 S582P probably benign Het
Ppargc1a C T 5: 51,463,215 probably benign Het
Ptchd4 A T 17: 42,502,455 I416L probably benign Het
Rhpn1 G A 15: 75,714,119 R627H probably benign Het
Ric8a G A 7: 140,861,337 G182S probably damaging Het
Rims1 T C 1: 22,373,494 D895G probably damaging Het
Rrp1b G A 17: 32,056,010 probably benign Het
Rtf1 T A 2: 119,730,729 D636E probably benign Het
Scn3a T C 2: 65,524,179 D333G probably benign Het
Sema6a A G 18: 47,291,923 L207P probably damaging Het
Shcbp1 A T 8: 4,749,779 Y160* probably null Het
Slc27a1 A T 8: 71,580,066 probably null Het
Ston2 C T 12: 91,641,872 R818Q probably damaging Het
Tipin T A 9: 64,288,103 probably null Het
Tjap1 A T 17: 46,260,027 probably null Het
Vmn1r117 A T 7: 20,883,592 F177Y probably damaging Het
Vmn1r57 A G 7: 5,220,668 D64G possibly damaging Het
Vmn2r73 T A 7: 85,875,847 D31V probably benign Het
Vmn2r-ps41 A T 7: 9,177,064 noncoding transcript Het
Other mutations in Noct
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01544:Noct APN 3 51248048 missense probably damaging 0.99
R0256:Noct UTSW 3 51250474 missense probably damaging 1.00
R1399:Noct UTSW 3 51250476 unclassified probably null
R1539:Noct UTSW 3 51247912 nonsense probably null
R1618:Noct UTSW 3 51247830 missense probably damaging 1.00
R2001:Noct UTSW 3 51248044 missense probably damaging 1.00
R2176:Noct UTSW 3 51249696 critical splice acceptor site probably null
R2408:Noct UTSW 3 51225289 critical splice donor site probably null
R4413:Noct UTSW 3 51250335 missense probably damaging 1.00
R4690:Noct UTSW 3 51247879 nonsense probably null
R4993:Noct UTSW 3 51250021 missense probably damaging 1.00
R5009:Noct UTSW 3 51248061 missense probably damaging 1.00
R6467:Noct UTSW 3 51250087 missense possibly damaging 0.90
R6631:Noct UTSW 3 51250200 missense probably damaging 1.00
R7454:Noct UTSW 3 51249730 missense probably damaging 1.00
R7467:Noct UTSW 3 51225201 missense probably benign 0.01
R7992:Noct UTSW 3 51247648 intron probably benign
Predicted Primers PCR Primer
(F):5'- CAGCACCAATATTAGGCTGACAG -3'
(R):5'- GGAGTACCAGATATAGTCCAGCG -3'

Sequencing Primer
(F):5'- GCTGACAGCCATGACCC -3'
(R):5'- CTCGCCTGAGGTCCGGATC -3'
Posted On2015-08-18