Incidental Mutation 'R4552:Ppargc1a'
ID334001
Institutional Source Beutler Lab
Gene Symbol Ppargc1a
Ensembl Gene ENSMUSG00000029167
Gene Nameperoxisome proliferative activated receptor, gamma, coactivator 1 alpha
SynonymsA830037N07Rik, Gm11133, Pgco1, Pgc1, PPAR Gamma Coactivator-1, Pgc-1alpha, Pgc-1alphaa
MMRRC Submission 041783-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.738) question?
Stock #R4552 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location51454250-51567726 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 51463215 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031059] [ENSMUST00000132734] [ENSMUST00000151104] [ENSMUST00000196968]
Predicted Effect probably benign
Transcript: ENSMUST00000031059
SMART Domains Protein: ENSMUSP00000138397
Gene: ENSMUSG00000029167

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
low complexity region 141 147 N/A INTRINSIC
PDB:3D24|D 197 218 1e-7 PDB
Predicted Effect unknown
Transcript: ENSMUST00000132734
AA Change: R710Q
SMART Domains Protein: ENSMUSP00000117040
Gene: ENSMUSG00000029167
AA Change: R710Q

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
low complexity region 141 147 N/A INTRINSIC
PDB:3D24|D 197 218 4e-7 PDB
low complexity region 294 300 N/A INTRINSIC
low complexity region 558 613 N/A INTRINSIC
low complexity region 615 636 N/A INTRINSIC
RRM 677 746 4.61e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151104
SMART Domains Protein: ENSMUSP00000116566
Gene: ENSMUSG00000029167

DomainStartEndE-ValueType
low complexity region 19 36 N/A INTRINSIC
low complexity region 137 143 N/A INTRINSIC
PDB:3D24|D 193 214 1e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000196968
SMART Domains Protein: ENSMUSP00000143553
Gene: ENSMUSG00000029167

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
low complexity region 141 147 N/A INTRINSIC
PDB:3D24|D 197 218 4e-7 PDB
low complexity region 294 300 N/A INTRINSIC
low complexity region 558 613 N/A INTRINSIC
low complexity region 615 636 N/A INTRINSIC
Meta Mutation Damage Score 0.0858 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: This gene encodes a transcriptional coactivator that induces and coordinates gene expression regulating mitochondrial biogenesis, respiration, hepatic gluconeogenesis, thermogenic program in brown fat and muscle fiber-type switching. Mice lacking the encoded protein exhibit reduced thermogenic capacity, hyperactivity and resistance to diet-induced obesity. Mice lacking the encoded protein specifically in the heart exhibit peripartum cardiomyopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice display partial postnatal lethality, abnormal glucose and insulin homeostasis, resistance to diet induced obesity, increased oxygen consumption, spongiform encephalopathy, hyperactivity, increased startle reflex, and limb grasping. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Arhgap33 A T 7: 30,519,108 probably benign Het
Arid1a A C 4: 133,695,699 probably benign Het
C4bp A G 1: 130,636,727 Y407H possibly damaging Het
Camta1 T C 4: 151,792,502 R79G probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Cep128 T C 12: 91,294,162 E309G probably damaging Het
Chit1 A G 1: 134,144,051 T100A probably benign Het
Dalrd3 A G 9: 108,572,230 D454G possibly damaging Het
Ddx19a G A 8: 110,978,566 Q308* probably null Het
Dmxl2 T C 9: 54,451,763 N395S probably damaging Het
Dnah17 T C 11: 118,052,943 D3125G possibly damaging Het
Dnah5 T C 15: 28,397,154 V3331A probably benign Het
Dnah9 T C 11: 65,841,366 E4238G probably damaging Het
Dner T C 1: 84,383,857 Y677C probably damaging Het
Epgn A T 5: 91,027,562 K14* probably null Het
Hid1 G A 11: 115,358,679 T240M possibly damaging Het
Igbp1b T A 6: 138,658,114 M111L probably benign Het
Kif26b T A 1: 178,884,035 I740N probably damaging Het
Klk4 C A 7: 43,884,019 H101N probably benign Het
Mrgpra2b C A 7: 47,464,006 S300I probably benign Het
Mtss1l A G 8: 110,738,505 T464A probably damaging Het
Nbas T C 12: 13,335,937 probably null Het
Nif3l1 C T 1: 58,449,324 probably benign Het
Noct T A 3: 51,250,168 I309N probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Odf2l A T 3: 145,151,083 T600S probably benign Het
Odf4 C T 11: 68,922,040 S264N probably benign Het
Olfr1391 A T 11: 49,327,950 M180L probably benign Het
Olfr24 A G 9: 18,755,134 V167A possibly damaging Het
Olfr45 A T 7: 140,691,742 Y279F probably damaging Het
Olfr815 T C 10: 129,902,123 M196V probably benign Het
Papolb T C 5: 142,529,178 I237V probably benign Het
Parpbp T A 10: 88,093,702 Q428L possibly damaging Het
Pclo T C 5: 14,669,271 S1141P unknown Het
Plcb1 T C 2: 135,335,493 S582P probably benign Het
Ptchd4 A T 17: 42,502,455 I416L probably benign Het
Rhpn1 G A 15: 75,714,119 R627H probably benign Het
Ric8a G A 7: 140,861,337 G182S probably damaging Het
Rims1 T C 1: 22,373,494 D895G probably damaging Het
Rrp1b G A 17: 32,056,010 probably benign Het
Rtf1 T A 2: 119,730,729 D636E probably benign Het
Scn3a T C 2: 65,524,179 D333G probably benign Het
Sema6a A G 18: 47,291,923 L207P probably damaging Het
Shcbp1 A T 8: 4,749,779 Y160* probably null Het
Slc27a1 A T 8: 71,580,066 probably null Het
Ston2 C T 12: 91,641,872 R818Q probably damaging Het
Tipin T A 9: 64,288,103 probably null Het
Tjap1 A T 17: 46,260,027 probably null Het
Vmn1r117 A T 7: 20,883,592 F177Y probably damaging Het
Vmn1r57 A G 7: 5,220,668 D64G possibly damaging Het
Vmn2r73 T A 7: 85,875,847 D31V probably benign Het
Vmn2r-ps41 A T 7: 9,177,064 noncoding transcript Het
Other mutations in Ppargc1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Ppargc1a APN 5 51498031 splice site probably null
IGL01063:Ppargc1a APN 5 51474322 missense probably benign 0.43
IGL01800:Ppargc1a APN 5 51494721 missense probably damaging 1.00
IGL02179:Ppargc1a APN 5 51473711 missense possibly damaging 0.90
IGL02336:Ppargc1a APN 5 51495726 nonsense probably null
IGL02368:Ppargc1a APN 5 51474156 missense probably benign 0.05
R1300:Ppargc1a UTSW 5 51548672 missense probably damaging 1.00
R2048:Ppargc1a UTSW 5 51548516 missense probably damaging 1.00
R2054:Ppargc1a UTSW 5 51473788 missense possibly damaging 0.47
R2211:Ppargc1a UTSW 5 51474259 missense possibly damaging 0.47
R2848:Ppargc1a UTSW 5 51473809 missense probably benign 0.02
R4094:Ppargc1a UTSW 5 51490064 missense possibly damaging 0.47
R4419:Ppargc1a UTSW 5 51494702 missense probably damaging 1.00
R4702:Ppargc1a UTSW 5 51495696 missense possibly damaging 0.73
R4855:Ppargc1a UTSW 5 51474222 missense possibly damaging 0.89
R5287:Ppargc1a UTSW 5 51462825 intron probably benign
R5313:Ppargc1a UTSW 5 51458239 utr 3 prime probably benign
R5403:Ppargc1a UTSW 5 51462825 intron probably benign
R5711:Ppargc1a UTSW 5 51474220 missense probably damaging 1.00
R5918:Ppargc1a UTSW 5 51463237 intron probably benign
R5940:Ppargc1a UTSW 5 51473911 missense probably damaging 1.00
R6170:Ppargc1a UTSW 5 51473911 missense probably damaging 1.00
R6415:Ppargc1a UTSW 5 51462834 intron probably benign
R7718:Ppargc1a UTSW 5 51498162 missense probably damaging 1.00
R7755:Ppargc1a UTSW 5 51473541 missense unknown
R7849:Ppargc1a UTSW 5 51548513 missense probably benign 0.45
R7932:Ppargc1a UTSW 5 51548513 missense probably benign 0.45
X0019:Ppargc1a UTSW 5 51548678 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATTGTCCTGTCAGGCAGC -3'
(R):5'- TGCTCTGTGAGATTGTGTACAC -3'

Sequencing Primer
(F):5'- TGTCCTGTCAGGCAGCTAAATAC -3'
(R):5'- CACTATTATGTGTTCATGGATGCTTG -3'
Posted On2015-08-18