Incidental Mutation 'R0207:Dpy19l1'
ID 33401
Institutional Source Beutler Lab
Gene Symbol Dpy19l1
Ensembl Gene ENSMUSG00000043067
Gene Name dpy-19 like C-mannosyltransferase 1
Synonyms 1100001I19Rik
MMRRC Submission 038460-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.160) question?
Stock # R0207 (G1)
Quality Score 192
Status Not validated
Chromosome 9
Chromosomal Location 24323074-24414436 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 24365187 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 275 (R275C)
Ref Sequence ENSEMBL: ENSMUSP00000129575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115277] [ENSMUST00000142064] [ENSMUST00000170356]
AlphaFold A6X919
Predicted Effect probably damaging
Transcript: ENSMUST00000115277
AA Change: R81C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110932
Gene: ENSMUSG00000043067
AA Change: R81C

DomainStartEndE-ValueType
Pfam:Dpy19 10 549 1.6e-212 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000142064
AA Change: R275C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119986
Gene: ENSMUSG00000043067
AA Change: R275C

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
low complexity region 42 69 N/A INTRINSIC
Pfam:Dpy19 99 743 2e-247 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170356
AA Change: R275C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129575
Gene: ENSMUSG00000043067
AA Change: R275C

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
low complexity region 42 69 N/A INTRINSIC
Pfam:Dpy19 98 743 5.5e-264 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.5%
Validation Efficiency 95% (76/80)
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,086,039 (GRCm39) F488S probably damaging Het
Acap3 C T 4: 155,983,881 (GRCm39) R116W probably damaging Het
Adamts10 C A 17: 33,764,364 (GRCm39) P663T possibly damaging Het
Akap12 G A 10: 4,303,333 (GRCm39) G48S probably damaging Het
Ankrd7 T A 6: 18,870,030 (GRCm39) M261K probably benign Het
Ankzf1 C A 1: 75,174,948 (GRCm39) D599E possibly damaging Het
Aox1 T C 1: 58,144,173 (GRCm39) I1278T possibly damaging Het
Apcdd1 T C 18: 63,083,150 (GRCm39) Y327H probably benign Het
Asxl3 T A 18: 22,544,553 (GRCm39) probably benign Het
Birc6 C A 17: 74,969,827 (GRCm39) probably benign Het
Btaf1 T A 19: 36,987,048 (GRCm39) L1714* probably null Het
Cacng6 T A 7: 3,473,520 (GRCm39) probably benign Het
Cdc20b A G 13: 113,215,146 (GRCm39) D238G probably damaging Het
Celf5 T A 10: 81,306,532 (GRCm39) R113W probably null Het
Cfap251 T C 5: 123,421,510 (GRCm39) V182A probably damaging Het
Cfap70 C A 14: 20,462,415 (GRCm39) E659D probably damaging Het
Clspn T A 4: 126,484,391 (GRCm39) M1183K possibly damaging Het
Dst C T 1: 34,226,016 (GRCm39) S1721L probably benign Het
Faap100 T C 11: 120,265,191 (GRCm39) T562A probably damaging Het
Fam168b T C 1: 34,858,769 (GRCm39) M133V probably damaging Het
Farp2 T C 1: 93,496,809 (GRCm39) I172T probably damaging Het
Fer T G 17: 64,203,273 (GRCm39) S68A probably damaging Het
Fmo5 A G 3: 97,552,997 (GRCm39) E315G probably damaging Het
Gpr89 A T 3: 96,778,796 (GRCm39) F426I probably damaging Het
Hinfp T C 9: 44,207,624 (GRCm39) I461V possibly damaging Het
Hsd11b1 A T 1: 192,922,556 (GRCm39) V167D probably damaging Het
Htt A G 5: 35,054,252 (GRCm39) K2574E probably benign Het
I830077J02Rik A G 3: 105,833,821 (GRCm39) S112P probably benign Het
Igf2bp3 T A 6: 49,082,551 (GRCm39) M344L probably benign Het
Itch A T 2: 155,044,177 (GRCm39) Q494L probably benign Het
Itga9 T C 9: 118,598,321 (GRCm39) probably benign Het
Jaml T A 9: 45,005,065 (GRCm39) D152E probably benign Het
Kif22 A C 7: 126,641,572 (GRCm39) M1R probably null Het
Kifap3 T C 1: 163,710,955 (GRCm39) Y663H probably benign Het
Letm2 T A 8: 26,068,786 (GRCm39) N472I probably damaging Het
Mthfr T G 4: 148,136,681 (GRCm39) V446G probably damaging Het
Myh11 T C 16: 14,029,124 (GRCm39) E1206G possibly damaging Het
Myo6 G A 9: 80,195,338 (GRCm39) V903I probably damaging Het
Myo9b C T 8: 71,807,869 (GRCm39) probably benign Het
Nr2f2 G C 7: 70,009,923 (GRCm39) P52R probably damaging Het
Nsd3 A G 8: 26,173,273 (GRCm39) N859S probably benign Het
Nucb2 C A 7: 116,135,245 (GRCm39) A384E probably damaging Het
Ogdhl C A 14: 32,063,994 (GRCm39) probably null Het
Or10al3 C A 17: 38,011,949 (GRCm39) C129* probably null Het
Or1e22 A T 11: 73,377,401 (GRCm39) L83Q probably benign Het
Or1i2 T C 10: 78,447,705 (GRCm39) T257A probably benign Het
Or4a74 G A 2: 89,440,207 (GRCm39) L80F probably damaging Het
Or5b105 G A 19: 13,080,642 (GRCm39) R3C possibly damaging Het
Parp10 C T 15: 76,126,833 (GRCm39) S145N probably benign Het
Pigh A G 12: 79,130,483 (GRCm39) probably benign Het
Pigo A G 4: 43,023,824 (GRCm39) probably benign Het
Pkp4 T A 2: 59,135,832 (GRCm39) V199D possibly damaging Het
Polr1e C A 4: 45,025,143 (GRCm39) probably null Het
Ppfia3 C A 7: 44,997,958 (GRCm39) R723L probably damaging Het
Prex1 C A 2: 166,427,818 (GRCm39) A945S possibly damaging Het
Prrt3 A T 6: 113,472,801 (GRCm39) V457E probably damaging Het
Rab39 A G 9: 53,617,271 (GRCm39) F49L possibly damaging Het
Rrs1 C A 1: 9,615,987 (GRCm39) probably null Het
Rrs1 G A 1: 9,615,992 (GRCm39) E82K probably damaging Het
Serpinb3c T C 1: 107,204,722 (GRCm39) D8G probably benign Het
Slc17a6 A G 7: 51,295,928 (GRCm39) probably benign Het
Slc24a4 T A 12: 102,195,210 (GRCm39) probably null Het
Smc1b C T 15: 85,007,960 (GRCm39) M272I probably benign Het
Smc6 T C 12: 11,333,179 (GRCm39) probably benign Het
Tcf20 T C 15: 82,739,286 (GRCm39) T722A probably benign Het
Tesmin A T 19: 3,454,088 (GRCm39) M141L probably benign Het
Tmprss5 T A 9: 49,024,460 (GRCm39) H274Q possibly damaging Het
Tns1 C T 1: 73,976,477 (GRCm39) probably null Het
Tpr T C 1: 150,293,178 (GRCm39) S868P possibly damaging Het
Trank1 C T 9: 111,195,321 (GRCm39) T1115I probably damaging Het
Trmt44 A T 5: 35,730,261 (GRCm39) I203K possibly damaging Het
Ulk2 A T 11: 61,668,611 (GRCm39) V1037E probably benign Het
Usp43 A G 11: 67,767,325 (GRCm39) Y682H probably damaging Het
Vipr2 A T 12: 116,106,502 (GRCm39) Q366L probably damaging Het
Vmn1r185 C A 7: 26,311,014 (GRCm39) V164L possibly damaging Het
Vmn2r120 C T 17: 57,832,052 (GRCm39) V246I probably benign Het
Wiz C T 17: 32,576,007 (GRCm39) G790R probably damaging Het
Wnk1 A T 6: 119,929,694 (GRCm39) S1016R probably damaging Het
Zc3hav1 A G 6: 38,288,109 (GRCm39) L909S probably benign Het
Zfp236 T A 18: 82,658,352 (GRCm39) I637F probably damaging Het
Zfp788 G A 7: 41,299,020 (GRCm39) G532D probably damaging Het
Zranb1 T C 7: 132,552,114 (GRCm39) I255T probably damaging Het
Other mutations in Dpy19l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Dpy19l1 APN 9 24,393,226 (GRCm39) missense probably damaging 0.99
IGL00788:Dpy19l1 APN 9 24,373,864 (GRCm39) splice site probably benign
IGL00959:Dpy19l1 APN 9 24,334,493 (GRCm39) splice site probably null
IGL01646:Dpy19l1 APN 9 24,396,365 (GRCm39) missense probably damaging 0.99
IGL01647:Dpy19l1 APN 9 24,396,365 (GRCm39) missense probably damaging 0.99
IGL01713:Dpy19l1 APN 9 24,396,365 (GRCm39) missense probably damaging 0.99
IGL01715:Dpy19l1 APN 9 24,396,365 (GRCm39) missense probably damaging 0.99
IGL01743:Dpy19l1 APN 9 24,396,365 (GRCm39) missense probably damaging 0.99
IGL01912:Dpy19l1 APN 9 24,396,365 (GRCm39) missense probably damaging 0.99
IGL02417:Dpy19l1 APN 9 24,386,682 (GRCm39) missense possibly damaging 0.48
IGL02629:Dpy19l1 APN 9 24,350,009 (GRCm39) splice site probably benign
IGL02677:Dpy19l1 APN 9 24,396,368 (GRCm39) missense probably damaging 1.00
IGL02949:Dpy19l1 APN 9 24,332,476 (GRCm39) missense probably benign 0.44
IGL03067:Dpy19l1 APN 9 24,349,956 (GRCm39) missense probably benign 0.00
G1Funyon:Dpy19l1 UTSW 9 24,396,407 (GRCm39) splice site probably benign
R0066:Dpy19l1 UTSW 9 24,325,705 (GRCm39) missense possibly damaging 0.95
R0462:Dpy19l1 UTSW 9 24,325,645 (GRCm39) missense probably benign 0.01
R0544:Dpy19l1 UTSW 9 24,396,406 (GRCm39) splice site probably benign
R0749:Dpy19l1 UTSW 9 24,373,880 (GRCm39) missense probably benign 0.35
R0838:Dpy19l1 UTSW 9 24,343,727 (GRCm39) missense probably damaging 0.98
R1114:Dpy19l1 UTSW 9 24,336,072 (GRCm39) missense probably benign 0.30
R1546:Dpy19l1 UTSW 9 24,386,680 (GRCm39) missense probably damaging 0.98
R1767:Dpy19l1 UTSW 9 24,373,880 (GRCm39) missense probably benign 0.35
R1926:Dpy19l1 UTSW 9 24,385,120 (GRCm39) missense probably benign
R1933:Dpy19l1 UTSW 9 24,345,683 (GRCm39) missense probably damaging 0.99
R2046:Dpy19l1 UTSW 9 24,334,455 (GRCm39) missense probably damaging 0.98
R2101:Dpy19l1 UTSW 9 24,393,331 (GRCm39) missense probably damaging 0.99
R4083:Dpy19l1 UTSW 9 24,396,344 (GRCm39) missense possibly damaging 0.86
R4565:Dpy19l1 UTSW 9 24,343,684 (GRCm39) missense probably null 1.00
R4649:Dpy19l1 UTSW 9 24,393,350 (GRCm39) missense possibly damaging 0.94
R4652:Dpy19l1 UTSW 9 24,393,350 (GRCm39) missense possibly damaging 0.94
R4653:Dpy19l1 UTSW 9 24,393,350 (GRCm39) missense possibly damaging 0.94
R4669:Dpy19l1 UTSW 9 24,343,664 (GRCm39) missense possibly damaging 0.94
R4746:Dpy19l1 UTSW 9 24,361,966 (GRCm39) missense probably benign 0.29
R4769:Dpy19l1 UTSW 9 24,337,444 (GRCm39) missense probably damaging 0.99
R4785:Dpy19l1 UTSW 9 24,336,119 (GRCm39) missense probably damaging 1.00
R5177:Dpy19l1 UTSW 9 24,349,924 (GRCm39) critical splice donor site probably null
R5466:Dpy19l1 UTSW 9 24,325,684 (GRCm39) missense probably damaging 0.99
R5707:Dpy19l1 UTSW 9 24,325,563 (GRCm39) makesense probably null
R6265:Dpy19l1 UTSW 9 24,343,667 (GRCm39) missense possibly damaging 0.88
R6266:Dpy19l1 UTSW 9 24,350,442 (GRCm39) missense probably damaging 0.99
R6290:Dpy19l1 UTSW 9 24,373,896 (GRCm39) missense probably damaging 1.00
R6380:Dpy19l1 UTSW 9 24,393,341 (GRCm39) nonsense probably null
R6478:Dpy19l1 UTSW 9 24,361,992 (GRCm39) missense possibly damaging 0.88
R6581:Dpy19l1 UTSW 9 24,359,160 (GRCm39) missense possibly damaging 0.68
R6756:Dpy19l1 UTSW 9 24,385,080 (GRCm39) missense probably damaging 0.99
R6773:Dpy19l1 UTSW 9 24,352,068 (GRCm39) missense probably damaging 0.97
R6795:Dpy19l1 UTSW 9 24,414,158 (GRCm39) missense possibly damaging 0.53
R6796:Dpy19l1 UTSW 9 24,414,158 (GRCm39) missense possibly damaging 0.53
R7060:Dpy19l1 UTSW 9 24,334,419 (GRCm39) missense possibly damaging 0.88
R7862:Dpy19l1 UTSW 9 24,386,730 (GRCm39) missense probably damaging 1.00
R7921:Dpy19l1 UTSW 9 24,333,634 (GRCm39) missense possibly damaging 0.85
R8095:Dpy19l1 UTSW 9 24,396,160 (GRCm39) splice site probably null
R8192:Dpy19l1 UTSW 9 24,362,023 (GRCm39) missense possibly damaging 0.75
R8248:Dpy19l1 UTSW 9 24,414,191 (GRCm39) missense probably benign
R8296:Dpy19l1 UTSW 9 24,414,372 (GRCm39) missense probably benign 0.00
R8301:Dpy19l1 UTSW 9 24,396,407 (GRCm39) splice site probably benign
R8307:Dpy19l1 UTSW 9 24,414,297 (GRCm39) missense probably benign
R8328:Dpy19l1 UTSW 9 24,386,686 (GRCm39) nonsense probably null
R8975:Dpy19l1 UTSW 9 24,359,102 (GRCm39) missense probably damaging 0.98
R9283:Dpy19l1 UTSW 9 24,332,412 (GRCm39) nonsense probably null
R9661:Dpy19l1 UTSW 9 24,386,730 (GRCm39) missense probably damaging 1.00
X0025:Dpy19l1 UTSW 9 24,343,676 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGATTCTACGAATTCTGCTCCTGC -3'
(R):5'- CCCACTCACTTCCCAGAGGTTGTAT -3'

Sequencing Primer
(F):5'- GACACagaagaaaaggaaaaagaaag -3'
(R):5'- GTTGTATTTACAGAGAACCCAGCG -3'
Posted On 2013-05-09