Incidental Mutation 'R4552:Ddx19a'
ID334017
Institutional Source Beutler Lab
Gene Symbol Ddx19a
Ensembl Gene ENSMUSG00000015023
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 19a
SynonymsEif4a-rs1, Ddx19, DBP5
MMRRC Submission 041783-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R4552 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location110974996-110997800 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 110978566 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 308 (Q308*)
Ref Sequence ENSEMBL: ENSMUSP00000047898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040416]
Predicted Effect probably null
Transcript: ENSMUST00000040416
AA Change: Q308*
SMART Domains Protein: ENSMUSP00000047898
Gene: ENSMUSG00000015023
AA Change: Q308*

DomainStartEndE-ValueType
low complexity region 39 53 N/A INTRINSIC
DEXDc 110 309 8.58e-44 SMART
HELICc 346 433 2.59e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173183
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 97% (62/64)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Arhgap33 A T 7: 30,519,108 probably benign Het
Arid1a A C 4: 133,695,699 probably benign Het
C4bp A G 1: 130,636,727 Y407H possibly damaging Het
Camta1 T C 4: 151,792,502 R79G probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Cep128 T C 12: 91,294,162 E309G probably damaging Het
Chit1 A G 1: 134,144,051 T100A probably benign Het
Dalrd3 A G 9: 108,572,230 D454G possibly damaging Het
Dmxl2 T C 9: 54,451,763 N395S probably damaging Het
Dnah17 T C 11: 118,052,943 D3125G possibly damaging Het
Dnah5 T C 15: 28,397,154 V3331A probably benign Het
Dnah9 T C 11: 65,841,366 E4238G probably damaging Het
Dner T C 1: 84,383,857 Y677C probably damaging Het
Epgn A T 5: 91,027,562 K14* probably null Het
Hid1 G A 11: 115,358,679 T240M possibly damaging Het
Igbp1b T A 6: 138,658,114 M111L probably benign Het
Kif26b T A 1: 178,884,035 I740N probably damaging Het
Klk4 C A 7: 43,884,019 H101N probably benign Het
Mrgpra2b C A 7: 47,464,006 S300I probably benign Het
Mtss1l A G 8: 110,738,505 T464A probably damaging Het
Nbas T C 12: 13,335,937 probably null Het
Nif3l1 C T 1: 58,449,324 probably benign Het
Noct T A 3: 51,250,168 I309N probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Odf2l A T 3: 145,151,083 T600S probably benign Het
Odf4 C T 11: 68,922,040 S264N probably benign Het
Olfr1391 A T 11: 49,327,950 M180L probably benign Het
Olfr24 A G 9: 18,755,134 V167A possibly damaging Het
Olfr45 A T 7: 140,691,742 Y279F probably damaging Het
Olfr815 T C 10: 129,902,123 M196V probably benign Het
Papolb T C 5: 142,529,178 I237V probably benign Het
Parpbp T A 10: 88,093,702 Q428L possibly damaging Het
Pclo T C 5: 14,669,271 S1141P unknown Het
Plcb1 T C 2: 135,335,493 S582P probably benign Het
Ppargc1a C T 5: 51,463,215 probably benign Het
Ptchd4 A T 17: 42,502,455 I416L probably benign Het
Rhpn1 G A 15: 75,714,119 R627H probably benign Het
Ric8a G A 7: 140,861,337 G182S probably damaging Het
Rims1 T C 1: 22,373,494 D895G probably damaging Het
Rrp1b G A 17: 32,056,010 probably benign Het
Rtf1 T A 2: 119,730,729 D636E probably benign Het
Scn3a T C 2: 65,524,179 D333G probably benign Het
Sema6a A G 18: 47,291,923 L207P probably damaging Het
Shcbp1 A T 8: 4,749,779 Y160* probably null Het
Slc27a1 A T 8: 71,580,066 probably null Het
Ston2 C T 12: 91,641,872 R818Q probably damaging Het
Tipin T A 9: 64,288,103 probably null Het
Tjap1 A T 17: 46,260,027 probably null Het
Vmn1r117 A T 7: 20,883,592 F177Y probably damaging Het
Vmn1r57 A G 7: 5,220,668 D64G possibly damaging Het
Vmn2r73 T A 7: 85,875,847 D31V probably benign Het
Vmn2r-ps41 A T 7: 9,177,064 noncoding transcript Het
Other mutations in Ddx19a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Ddx19a APN 8 110976470 missense probably benign
IGL01395:Ddx19a APN 8 110990532 splice site probably benign
IGL01676:Ddx19a APN 8 110980989 critical splice donor site probably null
IGL02243:Ddx19a APN 8 110976456 missense probably benign 0.06
IGL02677:Ddx19a APN 8 110989609 missense probably benign 0.24
IGL02870:Ddx19a APN 8 110983626 missense probably damaging 1.00
R0416:Ddx19a UTSW 8 110979057 missense probably damaging 0.96
R1574:Ddx19a UTSW 8 110993111 splice site probably benign
R1664:Ddx19a UTSW 8 110989498 missense probably damaging 0.99
R4470:Ddx19a UTSW 8 110976479 missense probably benign 0.00
R4668:Ddx19a UTSW 8 110979084 missense probably damaging 1.00
R4847:Ddx19a UTSW 8 110977045 missense probably damaging 1.00
R5390:Ddx19a UTSW 8 110980631 nonsense probably null
R5815:Ddx19a UTSW 8 110979149 nonsense probably null
R6842:Ddx19a UTSW 8 110978625 missense possibly damaging 0.69
R7045:Ddx19a UTSW 8 110993074 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGAGAATTTGGTCCCTTTGAGTG -3'
(R):5'- GCTGCAGCCCATCTAGAATG -3'

Sequencing Primer
(F):5'- TCCCTTTGAGTGACAGGCTGAAC -3'
(R):5'- CTACCGCCTTGGAATGTTGCAAAG -3'
Posted On2015-08-18