Incidental Mutation 'R4552:Olfr24'
ID334018
Institutional Source Beutler Lab
Gene Symbol Olfr24
Ensembl Gene ENSMUSG00000054141
Gene Nameolfactory receptor 24
SynonymsMOR132-1, GA_x6K02T2PVTD-12498544-12497603, MTPCR51
MMRRC Submission 041783-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R4552 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location18751507-18763996 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18755134 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 167 (V167A)
Ref Sequence ENSEMBL: ENSMUSP00000149702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066997] [ENSMUST00000216754]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066997
AA Change: V167A

PolyPhen 2 Score 0.602 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000064189
Gene: ENSMUSG00000054141
AA Change: V167A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.6e-64 PFAM
Pfam:7TM_GPCR_Srsx 35 304 9.2e-9 PFAM
Pfam:7tm_1 41 290 3.2e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212239
AA Change: V167A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214366
Predicted Effect possibly damaging
Transcript: ENSMUST00000216754
AA Change: V167A

PolyPhen 2 Score 0.602 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.2876 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Arhgap33 A T 7: 30,519,108 probably benign Het
Arid1a A C 4: 133,695,699 probably benign Het
C4bp A G 1: 130,636,727 Y407H possibly damaging Het
Camta1 T C 4: 151,792,502 R79G probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Cep128 T C 12: 91,294,162 E309G probably damaging Het
Chit1 A G 1: 134,144,051 T100A probably benign Het
Dalrd3 A G 9: 108,572,230 D454G possibly damaging Het
Ddx19a G A 8: 110,978,566 Q308* probably null Het
Dmxl2 T C 9: 54,451,763 N395S probably damaging Het
Dnah17 T C 11: 118,052,943 D3125G possibly damaging Het
Dnah5 T C 15: 28,397,154 V3331A probably benign Het
Dnah9 T C 11: 65,841,366 E4238G probably damaging Het
Dner T C 1: 84,383,857 Y677C probably damaging Het
Epgn A T 5: 91,027,562 K14* probably null Het
Hid1 G A 11: 115,358,679 T240M possibly damaging Het
Igbp1b T A 6: 138,658,114 M111L probably benign Het
Kif26b T A 1: 178,884,035 I740N probably damaging Het
Klk4 C A 7: 43,884,019 H101N probably benign Het
Mrgpra2b C A 7: 47,464,006 S300I probably benign Het
Mtss1l A G 8: 110,738,505 T464A probably damaging Het
Nbas T C 12: 13,335,937 probably null Het
Nif3l1 C T 1: 58,449,324 probably benign Het
Noct T A 3: 51,250,168 I309N probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Odf2l A T 3: 145,151,083 T600S probably benign Het
Odf4 C T 11: 68,922,040 S264N probably benign Het
Olfr1391 A T 11: 49,327,950 M180L probably benign Het
Olfr45 A T 7: 140,691,742 Y279F probably damaging Het
Olfr815 T C 10: 129,902,123 M196V probably benign Het
Papolb T C 5: 142,529,178 I237V probably benign Het
Parpbp T A 10: 88,093,702 Q428L possibly damaging Het
Pclo T C 5: 14,669,271 S1141P unknown Het
Plcb1 T C 2: 135,335,493 S582P probably benign Het
Ppargc1a C T 5: 51,463,215 probably benign Het
Ptchd4 A T 17: 42,502,455 I416L probably benign Het
Rhpn1 G A 15: 75,714,119 R627H probably benign Het
Ric8a G A 7: 140,861,337 G182S probably damaging Het
Rims1 T C 1: 22,373,494 D895G probably damaging Het
Rrp1b G A 17: 32,056,010 probably benign Het
Rtf1 T A 2: 119,730,729 D636E probably benign Het
Scn3a T C 2: 65,524,179 D333G probably benign Het
Sema6a A G 18: 47,291,923 L207P probably damaging Het
Shcbp1 A T 8: 4,749,779 Y160* probably null Het
Slc27a1 A T 8: 71,580,066 probably null Het
Ston2 C T 12: 91,641,872 R818Q probably damaging Het
Tipin T A 9: 64,288,103 probably null Het
Tjap1 A T 17: 46,260,027 probably null Het
Vmn1r117 A T 7: 20,883,592 F177Y probably damaging Het
Vmn1r57 A G 7: 5,220,668 D64G possibly damaging Het
Vmn2r73 T A 7: 85,875,847 D31V probably benign Het
Vmn2r-ps41 A T 7: 9,177,064 noncoding transcript Het
Other mutations in Olfr24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02346:Olfr24 APN 9 18754769 missense probably damaging 0.97
IGL02371:Olfr24 APN 9 18754704 missense probably benign 0.07
IGL02555:Olfr24 APN 9 18755473 missense probably benign 0.40
IGL03025:Olfr24 APN 9 18755369 missense probably benign 0.00
IGL03259:Olfr24 APN 9 18755515 missense probably benign
IGL03050:Olfr24 UTSW 9 18755454 nonsense probably null
R0310:Olfr24 UTSW 9 18755333 missense possibly damaging 0.91
R0410:Olfr24 UTSW 9 18754841 missense probably damaging 0.96
R2152:Olfr24 UTSW 9 18755095 missense probably damaging 1.00
R2153:Olfr24 UTSW 9 18755095 missense probably damaging 1.00
R2918:Olfr24 UTSW 9 18755479 missense probably damaging 1.00
R5073:Olfr24 UTSW 9 18754822 missense possibly damaging 0.89
R5539:Olfr24 UTSW 9 18754838 missense probably damaging 0.99
R5662:Olfr24 UTSW 9 18755600 missense probably damaging 0.99
R6145:Olfr24 UTSW 9 18755569 missense probably benign 0.06
R7125:Olfr24 UTSW 9 18754878 nonsense probably null
R7196:Olfr24 UTSW 9 18755590 nonsense probably null
R7607:Olfr24 UTSW 9 18754882 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCATGATGGCCACGATGATTC -3'
(R):5'- TATCCTTGTTGTCTGACCCAGATG -3'

Sequencing Primer
(F):5'- TGATTCGAGCATAGGAGGCC -3'
(R):5'- TTTGGCATCATGGACAGTGTC -3'
Posted On2015-08-18