Incidental Mutation 'R4552:Olfr815'
ID334023
Institutional Source Beutler Lab
Gene Symbol Olfr815
Ensembl Gene ENSMUSG00000061961
Gene Nameolfactory receptor 815
SynonymsGA_x6K02T2PULF-11581263-11580331, MOR113-3
MMRRC Submission 041783-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R4552 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129900570-129905867 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129902123 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 196 (M196V)
Ref Sequence ENSEMBL: ENSMUSP00000151146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071557] [ENSMUST00000205013] [ENSMUST00000216182]
Predicted Effect probably benign
Transcript: ENSMUST00000071557
AA Change: M202V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000071488
Gene: ENSMUSG00000061961
AA Change: M202V

DomainStartEndE-ValueType
Pfam:7tm_4 35 313 4.2e-45 PFAM
Pfam:7tm_1 45 294 1.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205013
AA Change: M196V
SMART Domains Protein: ENSMUSP00000145482
Gene: ENSMUSG00000049052
AA Change: M196V

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 1.3e-44 PFAM
Pfam:7tm_1 39 288 4.1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216182
AA Change: M196V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Arhgap33 A T 7: 30,519,108 probably benign Het
Arid1a A C 4: 133,695,699 probably benign Het
C4bp A G 1: 130,636,727 Y407H possibly damaging Het
Camta1 T C 4: 151,792,502 R79G probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Cep128 T C 12: 91,294,162 E309G probably damaging Het
Chit1 A G 1: 134,144,051 T100A probably benign Het
Dalrd3 A G 9: 108,572,230 D454G possibly damaging Het
Ddx19a G A 8: 110,978,566 Q308* probably null Het
Dmxl2 T C 9: 54,451,763 N395S probably damaging Het
Dnah17 T C 11: 118,052,943 D3125G possibly damaging Het
Dnah5 T C 15: 28,397,154 V3331A probably benign Het
Dnah9 T C 11: 65,841,366 E4238G probably damaging Het
Dner T C 1: 84,383,857 Y677C probably damaging Het
Epgn A T 5: 91,027,562 K14* probably null Het
Hid1 G A 11: 115,358,679 T240M possibly damaging Het
Igbp1b T A 6: 138,658,114 M111L probably benign Het
Kif26b T A 1: 178,884,035 I740N probably damaging Het
Klk4 C A 7: 43,884,019 H101N probably benign Het
Mrgpra2b C A 7: 47,464,006 S300I probably benign Het
Mtss1l A G 8: 110,738,505 T464A probably damaging Het
Nbas T C 12: 13,335,937 probably null Het
Nif3l1 C T 1: 58,449,324 probably benign Het
Noct T A 3: 51,250,168 I309N probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Odf2l A T 3: 145,151,083 T600S probably benign Het
Odf4 C T 11: 68,922,040 S264N probably benign Het
Olfr1391 A T 11: 49,327,950 M180L probably benign Het
Olfr24 A G 9: 18,755,134 V167A possibly damaging Het
Olfr45 A T 7: 140,691,742 Y279F probably damaging Het
Papolb T C 5: 142,529,178 I237V probably benign Het
Parpbp T A 10: 88,093,702 Q428L possibly damaging Het
Pclo T C 5: 14,669,271 S1141P unknown Het
Plcb1 T C 2: 135,335,493 S582P probably benign Het
Ppargc1a C T 5: 51,463,215 probably benign Het
Ptchd4 A T 17: 42,502,455 I416L probably benign Het
Rhpn1 G A 15: 75,714,119 R627H probably benign Het
Ric8a G A 7: 140,861,337 G182S probably damaging Het
Rims1 T C 1: 22,373,494 D895G probably damaging Het
Rrp1b G A 17: 32,056,010 probably benign Het
Rtf1 T A 2: 119,730,729 D636E probably benign Het
Scn3a T C 2: 65,524,179 D333G probably benign Het
Sema6a A G 18: 47,291,923 L207P probably damaging Het
Shcbp1 A T 8: 4,749,779 Y160* probably null Het
Slc27a1 A T 8: 71,580,066 probably null Het
Ston2 C T 12: 91,641,872 R818Q probably damaging Het
Tipin T A 9: 64,288,103 probably null Het
Tjap1 A T 17: 46,260,027 probably null Het
Vmn1r117 A T 7: 20,883,592 F177Y probably damaging Het
Vmn1r57 A G 7: 5,220,668 D64G possibly damaging Het
Vmn2r73 T A 7: 85,875,847 D31V probably benign Het
Vmn2r-ps41 A T 7: 9,177,064 noncoding transcript Het
Other mutations in Olfr815
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Olfr815 APN 10 129902659 missense possibly damaging 0.94
IGL01901:Olfr815 APN 10 129901853 missense probably benign 0.19
IGL02687:Olfr815 APN 10 129902102 missense probably benign 0.00
IGL02932:Olfr815 APN 10 129902418 nonsense probably null
IGL03327:Olfr815 APN 10 129902582 missense possibly damaging 0.87
R0894:Olfr815 UTSW 10 129901882 missense probably damaging 0.97
R1299:Olfr815 UTSW 10 129902077 missense probably benign 0.32
R1544:Olfr815 UTSW 10 129902424 nonsense probably null
R1939:Olfr815 UTSW 10 129902101 missense probably damaging 0.96
R2379:Olfr815 UTSW 10 129901912 missense probably damaging 0.99
R2435:Olfr815 UTSW 10 129902304 missense possibly damaging 0.52
R2566:Olfr815 UTSW 10 129902095 missense probably damaging 1.00
R2892:Olfr815 UTSW 10 129901940 missense possibly damaging 0.60
R2905:Olfr815 UTSW 10 129902400 missense possibly damaging 0.93
R6566:Olfr815 UTSW 10 129902078 missense probably benign 0.00
R6988:Olfr815 UTSW 10 129902409 missense probably damaging 0.98
R7671:Olfr815 UTSW 10 129902353 missense probably damaging 1.00
Z1088:Olfr815 UTSW 10 129902683 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- GCACAGCTATTCCTTTGCTCAAAG -3'
(R):5'- CATCAGCTTGTCCTGGGTTC -3'

Sequencing Primer
(F):5'- AAGTCACTCTTTCATTTGCTGAAGGC -3'
(R):5'- CTTGGGTAACTGGATTCCTGG -3'
Posted On2015-08-18