Incidental Mutation 'R4552:Odf4'
ID334027
Institutional Source Beutler Lab
Gene Symbol Odf4
Ensembl Gene ENSMUSG00000032921
Gene Nameouter dense fiber of sperm tails 4
SynonymsOppo1
MMRRC Submission 041783-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4552 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location68921835-68927081 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 68922040 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 264 (S264N)
Ref Sequence ENSEMBL: ENSMUSP00000040050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038932] [ENSMUST00000125134] [ENSMUST00000130271]
Predicted Effect probably benign
Transcript: ENSMUST00000038932
AA Change: S264N

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000040050
Gene: ENSMUSG00000032921
AA Change: S264N

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 42 222 1.1e-8 PFAM
low complexity region 272 287 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125134
SMART Domains Protein: ENSMUSP00000133636
Gene: ENSMUSG00000032921

DomainStartEndE-ValueType
transmembrane domain 41 63 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130271
SMART Domains Protein: ENSMUSP00000134383
Gene: ENSMUSG00000032921

DomainStartEndE-ValueType
transmembrane domain 42 64 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156828
SMART Domains Protein: ENSMUSP00000133569
Gene: ENSMUSG00000032921

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is localized in the outer dense fibers of the tails of mature sperm. This protein is thought to have some important role in the sperm tail. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Arhgap33 A T 7: 30,519,108 probably benign Het
Arid1a A C 4: 133,695,699 probably benign Het
C4bp A G 1: 130,636,727 Y407H possibly damaging Het
Camta1 T C 4: 151,792,502 R79G probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Cep128 T C 12: 91,294,162 E309G probably damaging Het
Chit1 A G 1: 134,144,051 T100A probably benign Het
Dalrd3 A G 9: 108,572,230 D454G possibly damaging Het
Ddx19a G A 8: 110,978,566 Q308* probably null Het
Dmxl2 T C 9: 54,451,763 N395S probably damaging Het
Dnah17 T C 11: 118,052,943 D3125G possibly damaging Het
Dnah5 T C 15: 28,397,154 V3331A probably benign Het
Dnah9 T C 11: 65,841,366 E4238G probably damaging Het
Dner T C 1: 84,383,857 Y677C probably damaging Het
Epgn A T 5: 91,027,562 K14* probably null Het
Hid1 G A 11: 115,358,679 T240M possibly damaging Het
Igbp1b T A 6: 138,658,114 M111L probably benign Het
Kif26b T A 1: 178,884,035 I740N probably damaging Het
Klk4 C A 7: 43,884,019 H101N probably benign Het
Mrgpra2b C A 7: 47,464,006 S300I probably benign Het
Mtss1l A G 8: 110,738,505 T464A probably damaging Het
Nbas T C 12: 13,335,937 probably null Het
Nif3l1 C T 1: 58,449,324 probably benign Het
Noct T A 3: 51,250,168 I309N probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Odf2l A T 3: 145,151,083 T600S probably benign Het
Olfr1391 A T 11: 49,327,950 M180L probably benign Het
Olfr24 A G 9: 18,755,134 V167A possibly damaging Het
Olfr45 A T 7: 140,691,742 Y279F probably damaging Het
Olfr815 T C 10: 129,902,123 M196V probably benign Het
Papolb T C 5: 142,529,178 I237V probably benign Het
Parpbp T A 10: 88,093,702 Q428L possibly damaging Het
Pclo T C 5: 14,669,271 S1141P unknown Het
Plcb1 T C 2: 135,335,493 S582P probably benign Het
Ppargc1a C T 5: 51,463,215 probably benign Het
Ptchd4 A T 17: 42,502,455 I416L probably benign Het
Rhpn1 G A 15: 75,714,119 R627H probably benign Het
Ric8a G A 7: 140,861,337 G182S probably damaging Het
Rims1 T C 1: 22,373,494 D895G probably damaging Het
Rrp1b G A 17: 32,056,010 probably benign Het
Rtf1 T A 2: 119,730,729 D636E probably benign Het
Scn3a T C 2: 65,524,179 D333G probably benign Het
Sema6a A G 18: 47,291,923 L207P probably damaging Het
Shcbp1 A T 8: 4,749,779 Y160* probably null Het
Slc27a1 A T 8: 71,580,066 probably null Het
Ston2 C T 12: 91,641,872 R818Q probably damaging Het
Tipin T A 9: 64,288,103 probably null Het
Tjap1 A T 17: 46,260,027 probably null Het
Vmn1r117 A T 7: 20,883,592 F177Y probably damaging Het
Vmn1r57 A G 7: 5,220,668 D64G possibly damaging Het
Vmn2r73 T A 7: 85,875,847 D31V probably benign Het
Vmn2r-ps41 A T 7: 9,177,064 noncoding transcript Het
Other mutations in Odf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Odf4 APN 11 68921952 unclassified probably benign
IGL01782:Odf4 APN 11 68926633 missense probably damaging 0.98
R0030:Odf4 UTSW 11 68926941 missense probably benign 0.33
R0030:Odf4 UTSW 11 68926941 missense probably benign 0.33
R1945:Odf4 UTSW 11 68922157 missense possibly damaging 0.53
R4551:Odf4 UTSW 11 68922040 missense probably benign 0.02
R4685:Odf4 UTSW 11 68922839 critical splice donor site probably null
R4707:Odf4 UTSW 11 68926688 missense probably damaging 1.00
R5163:Odf4 UTSW 11 68922846 missense probably damaging 1.00
R6657:Odf4 UTSW 11 68926812 missense probably benign 0.12
R7073:Odf4 UTSW 11 68926688 missense probably damaging 1.00
R7508:Odf4 UTSW 11 68922423 missense possibly damaging 0.71
R7778:Odf4 UTSW 11 68922072 missense probably benign 0.01
R7824:Odf4 UTSW 11 68922072 missense probably benign 0.01
X0025:Odf4 UTSW 11 68926790 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTATTCCACATCACCTGAGCCA -3'
(R):5'- ATGCCACTTTCAGATTCCCC -3'

Sequencing Primer
(F):5'- CCACAGACAAAGCCAAGTTGAGG -3'
(R):5'- TCTTGTCCTCCCCCGCC -3'
Posted On2015-08-18