Incidental Mutation 'R4552:Hid1'
ID334028
Institutional Source Beutler Lab
Gene Symbol Hid1
Ensembl Gene ENSMUSG00000034586
Gene NameHID1 domain containing
SynonymsC630004H02Rik
MMRRC Submission 041783-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R4552 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location115347707-115367756 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 115358679 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 240 (T240M)
Ref Sequence ENSEMBL: ENSMUSP00000102152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044152] [ENSMUST00000106542]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044152
AA Change: T239M

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000043789
Gene: ENSMUSG00000034586
AA Change: T239M

DomainStartEndE-ValueType
Pfam:Dymeclin 1 763 3.9e-242 PFAM
Pfam:Hid1 1 784 3.1e-260 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106542
AA Change: T240M

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102152
Gene: ENSMUSG00000034586
AA Change: T240M

DomainStartEndE-ValueType
Pfam:Dymeclin 1 764 7.5e-275 PFAM
Pfam:Hid1 1 785 2.3e-261 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000123428
AA Change: T151M
SMART Domains Protein: ENSMUSP00000121914
Gene: ENSMUSG00000034586
AA Change: T151M

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
Pfam:Hid1 39 273 5.1e-78 PFAM
Pfam:Dymeclin 41 273 1.7e-70 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130073
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145316
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153447
Meta Mutation Damage Score 0.1186 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 97% (62/64)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Arhgap33 A T 7: 30,519,108 probably benign Het
Arid1a A C 4: 133,695,699 probably benign Het
C4bp A G 1: 130,636,727 Y407H possibly damaging Het
Camta1 T C 4: 151,792,502 R79G probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Cep128 T C 12: 91,294,162 E309G probably damaging Het
Chit1 A G 1: 134,144,051 T100A probably benign Het
Dalrd3 A G 9: 108,572,230 D454G possibly damaging Het
Ddx19a G A 8: 110,978,566 Q308* probably null Het
Dmxl2 T C 9: 54,451,763 N395S probably damaging Het
Dnah17 T C 11: 118,052,943 D3125G possibly damaging Het
Dnah5 T C 15: 28,397,154 V3331A probably benign Het
Dnah9 T C 11: 65,841,366 E4238G probably damaging Het
Dner T C 1: 84,383,857 Y677C probably damaging Het
Epgn A T 5: 91,027,562 K14* probably null Het
Igbp1b T A 6: 138,658,114 M111L probably benign Het
Kif26b T A 1: 178,884,035 I740N probably damaging Het
Klk4 C A 7: 43,884,019 H101N probably benign Het
Mrgpra2b C A 7: 47,464,006 S300I probably benign Het
Mtss1l A G 8: 110,738,505 T464A probably damaging Het
Nbas T C 12: 13,335,937 probably null Het
Nif3l1 C T 1: 58,449,324 probably benign Het
Noct T A 3: 51,250,168 I309N probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Odf2l A T 3: 145,151,083 T600S probably benign Het
Odf4 C T 11: 68,922,040 S264N probably benign Het
Olfr1391 A T 11: 49,327,950 M180L probably benign Het
Olfr24 A G 9: 18,755,134 V167A possibly damaging Het
Olfr45 A T 7: 140,691,742 Y279F probably damaging Het
Olfr815 T C 10: 129,902,123 M196V probably benign Het
Papolb T C 5: 142,529,178 I237V probably benign Het
Parpbp T A 10: 88,093,702 Q428L possibly damaging Het
Pclo T C 5: 14,669,271 S1141P unknown Het
Plcb1 T C 2: 135,335,493 S582P probably benign Het
Ppargc1a C T 5: 51,463,215 probably benign Het
Ptchd4 A T 17: 42,502,455 I416L probably benign Het
Rhpn1 G A 15: 75,714,119 R627H probably benign Het
Ric8a G A 7: 140,861,337 G182S probably damaging Het
Rims1 T C 1: 22,373,494 D895G probably damaging Het
Rrp1b G A 17: 32,056,010 probably benign Het
Rtf1 T A 2: 119,730,729 D636E probably benign Het
Scn3a T C 2: 65,524,179 D333G probably benign Het
Sema6a A G 18: 47,291,923 L207P probably damaging Het
Shcbp1 A T 8: 4,749,779 Y160* probably null Het
Slc27a1 A T 8: 71,580,066 probably null Het
Ston2 C T 12: 91,641,872 R818Q probably damaging Het
Tipin T A 9: 64,288,103 probably null Het
Tjap1 A T 17: 46,260,027 probably null Het
Vmn1r117 A T 7: 20,883,592 F177Y probably damaging Het
Vmn1r57 A G 7: 5,220,668 D64G possibly damaging Het
Vmn2r73 T A 7: 85,875,847 D31V probably benign Het
Vmn2r-ps41 A T 7: 9,177,064 noncoding transcript Het
Other mutations in Hid1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Hid1 APN 11 115359069 missense probably benign 0.05
IGL00783:Hid1 APN 11 115348510 missense probably damaging 1.00
IGL00935:Hid1 APN 11 115348498 missense probably damaging 1.00
IGL02081:Hid1 APN 11 115348506 missense possibly damaging 0.94
IGL02383:Hid1 APN 11 115352620 missense probably damaging 1.00
IGL02637:Hid1 APN 11 115350595 missense probably damaging 0.97
IGL03174:Hid1 APN 11 115360389 missense probably damaging 1.00
R0124:Hid1 UTSW 11 115356823 missense probably damaging 1.00
R0533:Hid1 UTSW 11 115348809 missense probably damaging 1.00
R1027:Hid1 UTSW 11 115355425 missense probably damaging 1.00
R1069:Hid1 UTSW 11 115356765 missense probably damaging 1.00
R1171:Hid1 UTSW 11 115352717 missense probably benign
R1583:Hid1 UTSW 11 115356750 missense possibly damaging 0.51
R1689:Hid1 UTSW 11 115360357 missense probably damaging 1.00
R1746:Hid1 UTSW 11 115354638 missense probably damaging 0.98
R1772:Hid1 UTSW 11 115348473 missense probably damaging 0.97
R1773:Hid1 UTSW 11 115348510 missense probably damaging 1.00
R1831:Hid1 UTSW 11 115348903 missense probably damaging 1.00
R2234:Hid1 UTSW 11 115351119 missense probably damaging 1.00
R2235:Hid1 UTSW 11 115351119 missense probably damaging 1.00
R2897:Hid1 UTSW 11 115350530 missense probably benign
R2898:Hid1 UTSW 11 115350530 missense probably benign
R3711:Hid1 UTSW 11 115358775 missense probably damaging 1.00
R4059:Hid1 UTSW 11 115356739 missense probably damaging 1.00
R4394:Hid1 UTSW 11 115367642 utr 5 prime probably benign
R4478:Hid1 UTSW 11 115361655 missense probably damaging 1.00
R4822:Hid1 UTSW 11 115355299 missense probably damaging 1.00
R5691:Hid1 UTSW 11 115348819 missense probably damaging 1.00
R5980:Hid1 UTSW 11 115350948 missense possibly damaging 0.64
R5981:Hid1 UTSW 11 115350948 missense possibly damaging 0.64
R6363:Hid1 UTSW 11 115352596 missense probably damaging 1.00
R6577:Hid1 UTSW 11 115354636 missense possibly damaging 0.89
R7191:Hid1 UTSW 11 115348469 makesense probably null
R7307:Hid1 UTSW 11 115348482 missense probably damaging 1.00
R7485:Hid1 UTSW 11 115354719 missense probably damaging 1.00
R7836:Hid1 UTSW 11 115358995 missense probably damaging 0.96
R7883:Hid1 UTSW 11 115354609 missense probably damaging 1.00
R7904:Hid1 UTSW 11 115355361 missense probably damaging 1.00
R7919:Hid1 UTSW 11 115358995 missense probably damaging 0.96
R7966:Hid1 UTSW 11 115354609 missense probably damaging 1.00
R7987:Hid1 UTSW 11 115355361 missense probably damaging 1.00
X0025:Hid1 UTSW 11 115348803 nonsense probably null
X0066:Hid1 UTSW 11 115354725 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGGGCCCTGATAGTAAGG -3'
(R):5'- TTGGCCTTACAGGGAGGAAC -3'

Sequencing Primer
(F):5'- TGTAACTCCTGTCCCAAGGG -3'
(R):5'- TTTTCCCCATGGGCCTGGG -3'
Posted On2015-08-18