Incidental Mutation 'R4552:Ptchd4'
ID334038
Institutional Source Beutler Lab
Gene Symbol Ptchd4
Ensembl Gene ENSMUSG00000042256
Gene Namepatched domain containing 4
Synonyms3110082D06Rik
MMRRC Submission 041783-MU
Accession Numbers

Ncbi RefSeq: NM_028474.1; MGI: 1920485

Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R4552 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location42315947-42507741 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 42502455 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 416 (I416L)
Ref Sequence ENSEMBL: ENSMUSP00000047640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048691]
Predicted Effect probably benign
Transcript: ENSMUST00000048691
AA Change: I416L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000047640
Gene: ENSMUSG00000042256
AA Change: I416L

DomainStartEndE-ValueType
Pfam:Patched 58 867 6.1e-102 PFAM
Pfam:Sterol-sensing 312 464 2.9e-26 PFAM
low complexity region 869 891 N/A INTRINSIC
Meta Mutation Damage Score 0.1173 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 97% (62/64)
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Arhgap33 A T 7: 30,519,108 probably benign Het
Arid1a A C 4: 133,695,699 probably benign Het
C4bp A G 1: 130,636,727 Y407H possibly damaging Het
Camta1 T C 4: 151,792,502 R79G probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Cep128 T C 12: 91,294,162 E309G probably damaging Het
Chit1 A G 1: 134,144,051 T100A probably benign Het
Dalrd3 A G 9: 108,572,230 D454G possibly damaging Het
Ddx19a G A 8: 110,978,566 Q308* probably null Het
Dmxl2 T C 9: 54,451,763 N395S probably damaging Het
Dnah17 T C 11: 118,052,943 D3125G possibly damaging Het
Dnah5 T C 15: 28,397,154 V3331A probably benign Het
Dnah9 T C 11: 65,841,366 E4238G probably damaging Het
Dner T C 1: 84,383,857 Y677C probably damaging Het
Epgn A T 5: 91,027,562 K14* probably null Het
Hid1 G A 11: 115,358,679 T240M possibly damaging Het
Igbp1b T A 6: 138,658,114 M111L probably benign Het
Kif26b T A 1: 178,884,035 I740N probably damaging Het
Klk4 C A 7: 43,884,019 H101N probably benign Het
Mrgpra2b C A 7: 47,464,006 S300I probably benign Het
Mtss1l A G 8: 110,738,505 T464A probably damaging Het
Nbas T C 12: 13,335,937 probably null Het
Nif3l1 C T 1: 58,449,324 probably benign Het
Noct T A 3: 51,250,168 I309N probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Odf2l A T 3: 145,151,083 T600S probably benign Het
Odf4 C T 11: 68,922,040 S264N probably benign Het
Olfr1391 A T 11: 49,327,950 M180L probably benign Het
Olfr24 A G 9: 18,755,134 V167A possibly damaging Het
Olfr45 A T 7: 140,691,742 Y279F probably damaging Het
Olfr815 T C 10: 129,902,123 M196V probably benign Het
Papolb T C 5: 142,529,178 I237V probably benign Het
Parpbp T A 10: 88,093,702 Q428L possibly damaging Het
Pclo T C 5: 14,669,271 S1141P unknown Het
Plcb1 T C 2: 135,335,493 S582P probably benign Het
Ppargc1a C T 5: 51,463,215 probably benign Het
Rhpn1 G A 15: 75,714,119 R627H probably benign Het
Ric8a G A 7: 140,861,337 G182S probably damaging Het
Rims1 T C 1: 22,373,494 D895G probably damaging Het
Rrp1b G A 17: 32,056,010 probably benign Het
Rtf1 T A 2: 119,730,729 D636E probably benign Het
Scn3a T C 2: 65,524,179 D333G probably benign Het
Sema6a A G 18: 47,291,923 L207P probably damaging Het
Shcbp1 A T 8: 4,749,779 Y160* probably null Het
Slc27a1 A T 8: 71,580,066 probably null Het
Ston2 C T 12: 91,641,872 R818Q probably damaging Het
Tipin T A 9: 64,288,103 probably null Het
Tjap1 A T 17: 46,260,027 probably null Het
Vmn1r117 A T 7: 20,883,592 F177Y probably damaging Het
Vmn1r57 A G 7: 5,220,668 D64G possibly damaging Het
Vmn2r73 T A 7: 85,875,847 D31V probably benign Het
Vmn2r-ps41 A T 7: 9,177,064 noncoding transcript Het
Other mutations in Ptchd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Ptchd4 APN 17 42316926 nonsense probably null
IGL01360:Ptchd4 APN 17 42317045 missense probably benign 0.09
IGL01814:Ptchd4 APN 17 42503286 missense possibly damaging 0.84
IGL01885:Ptchd4 APN 17 42503602 missense probably damaging 1.00
IGL01929:Ptchd4 APN 17 42503322 missense probably benign 0.02
IGL02371:Ptchd4 APN 17 42316974 missense possibly damaging 0.83
IGL02480:Ptchd4 APN 17 42502540 missense probably benign 0.38
IGL02507:Ptchd4 APN 17 42316873 missense possibly damaging 0.72
IGL02593:Ptchd4 APN 17 42317146 missense probably benign 0.24
IGL02861:Ptchd4 APN 17 42377317 missense probably damaging 1.00
IGL02884:Ptchd4 APN 17 42502449 missense possibly damaging 0.86
IGL03384:Ptchd4 APN 17 42502590 missense probably damaging 1.00
PIT4418001:Ptchd4 UTSW 17 42503089 missense probably damaging 1.00
R0030:Ptchd4 UTSW 17 42317108 nonsense probably null
R0243:Ptchd4 UTSW 17 42503416 missense probably damaging 1.00
R0398:Ptchd4 UTSW 17 42377259 missense possibly damaging 0.95
R0513:Ptchd4 UTSW 17 42503746 missense probably benign 0.14
R0630:Ptchd4 UTSW 17 42377185 missense probably benign 0.17
R0662:Ptchd4 UTSW 17 42502576 missense probably damaging 1.00
R1004:Ptchd4 UTSW 17 42377602 missense probably benign 0.00
R1433:Ptchd4 UTSW 17 42503715 missense possibly damaging 0.75
R1451:Ptchd4 UTSW 17 42502918 missense probably damaging 0.99
R1522:Ptchd4 UTSW 17 42503542 missense probably damaging 1.00
R1901:Ptchd4 UTSW 17 42503616 missense probably benign 0.10
R1902:Ptchd4 UTSW 17 42503616 missense probably benign 0.10
R2135:Ptchd4 UTSW 17 42317074 missense probably benign 0.01
R3935:Ptchd4 UTSW 17 42503489 missense possibly damaging 0.80
R4184:Ptchd4 UTSW 17 42502759 missense probably damaging 0.99
R4573:Ptchd4 UTSW 17 42502777 missense probably benign 0.26
R5100:Ptchd4 UTSW 17 42503676 missense possibly damaging 0.59
R5640:Ptchd4 UTSW 17 42503135 missense possibly damaging 0.73
R6213:Ptchd4 UTSW 17 42377360 missense probably benign 0.00
R6704:Ptchd4 UTSW 17 42317040 missense probably benign 0.00
R7011:Ptchd4 UTSW 17 42503868 missense probably benign 0.19
R7017:Ptchd4 UTSW 17 42502735 missense probably damaging 1.00
R7185:Ptchd4 UTSW 17 42503188 missense probably damaging 1.00
X0062:Ptchd4 UTSW 17 42377464 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGTCCATTTGAACCATAGGAGG -3'
(R):5'- GGTCCAGGTATTCTGCAGAAG -3'

Sequencing Primer
(F):5'- TTTCTCTTAACATTAGGTCATGGAAC -3'
(R):5'- TTCTGCAGAAGGGATCTTACAGC -3'
Posted On2015-08-18