Incidental Mutation 'R4552:Tjap1'
ID334039
Institutional Source Beutler Lab
Gene Symbol Tjap1
Ensembl Gene ENSMUSG00000012296
Gene Nametight junction associated protein 1
Synonyms0610041D19Rik, Tjp4, Pilt
MMRRC Submission 041783-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R4552 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location46257851-46283026 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 46260027 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012440] [ENSMUST00000095262] [ENSMUST00000164342] [ENSMUST00000180283] [ENSMUST00000224055] [ENSMUST00000224230] [ENSMUST00000224901] [ENSMUST00000225080] [ENSMUST00000225288] [ENSMUST00000225359] [ENSMUST00000225413] [ENSMUST00000225943]
Predicted Effect probably null
Transcript: ENSMUST00000012440
SMART Domains Protein: ENSMUSP00000012440
Gene: ENSMUSG00000012296

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
SCOP:d1fxkc_ 28 158 6e-3 SMART
low complexity region 204 215 N/A INTRINSIC
Pfam:Pilt 256 450 3.7e-83 PFAM
Pfam:Pilt 441 538 5.4e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095262
SMART Domains Protein: ENSMUSP00000092896
Gene: ENSMUSG00000071073

DomainStartEndE-ValueType
LRR 27 54 2.42e1 SMART
LRR 84 111 3.47e1 SMART
LRR 112 139 1.84e0 SMART
LRR 143 171 1.66e2 SMART
LRR 172 199 5.41e0 SMART
LRR 200 227 3.54e0 SMART
LRR 229 256 5.48e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000164342
SMART Domains Protein: ENSMUSP00000130710
Gene: ENSMUSG00000012296

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
SCOP:d1fxkc_ 28 158 6e-3 SMART
low complexity region 204 215 N/A INTRINSIC
Pfam:Pilt 262 447 1.5e-59 PFAM
Pfam:Pilt 442 538 1.1e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000180283
SMART Domains Protein: ENSMUSP00000137220
Gene: ENSMUSG00000012296

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
SCOP:d1fxkc_ 28 158 6e-3 SMART
low complexity region 204 215 N/A INTRINSIC
Pfam:Pilt 256 450 3.7e-83 PFAM
Pfam:Pilt 441 538 5.4e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224055
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224090
Predicted Effect probably benign
Transcript: ENSMUST00000224230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224696
Predicted Effect probably benign
Transcript: ENSMUST00000224901
Predicted Effect probably null
Transcript: ENSMUST00000225080
Predicted Effect probably benign
Transcript: ENSMUST00000225288
Predicted Effect probably benign
Transcript: ENSMUST00000225359
Predicted Effect probably null
Transcript: ENSMUST00000225413
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225915
Predicted Effect probably benign
Transcript: ENSMUST00000225943
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tight junction-associated protein. Incorporation of the encoded protein into tight junctions occurs at a late stage of formation of the junctions. The encoded protein localizes to the Golgi and may function in vesicle trafficking. Alternatively spliced transcript variants have been described. A related pseudogene exists on the X chromosome. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Arhgap33 A T 7: 30,519,108 probably benign Het
Arid1a A C 4: 133,695,699 probably benign Het
C4bp A G 1: 130,636,727 Y407H possibly damaging Het
Camta1 T C 4: 151,792,502 R79G probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Cep128 T C 12: 91,294,162 E309G probably damaging Het
Chit1 A G 1: 134,144,051 T100A probably benign Het
Dalrd3 A G 9: 108,572,230 D454G possibly damaging Het
Ddx19a G A 8: 110,978,566 Q308* probably null Het
Dmxl2 T C 9: 54,451,763 N395S probably damaging Het
Dnah17 T C 11: 118,052,943 D3125G possibly damaging Het
Dnah5 T C 15: 28,397,154 V3331A probably benign Het
Dnah9 T C 11: 65,841,366 E4238G probably damaging Het
Dner T C 1: 84,383,857 Y677C probably damaging Het
Epgn A T 5: 91,027,562 K14* probably null Het
Hid1 G A 11: 115,358,679 T240M possibly damaging Het
Igbp1b T A 6: 138,658,114 M111L probably benign Het
Kif26b T A 1: 178,884,035 I740N probably damaging Het
Klk4 C A 7: 43,884,019 H101N probably benign Het
Mrgpra2b C A 7: 47,464,006 S300I probably benign Het
Mtss1l A G 8: 110,738,505 T464A probably damaging Het
Nbas T C 12: 13,335,937 probably null Het
Nif3l1 C T 1: 58,449,324 probably benign Het
Noct T A 3: 51,250,168 I309N probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Odf2l A T 3: 145,151,083 T600S probably benign Het
Odf4 C T 11: 68,922,040 S264N probably benign Het
Olfr1391 A T 11: 49,327,950 M180L probably benign Het
Olfr24 A G 9: 18,755,134 V167A possibly damaging Het
Olfr45 A T 7: 140,691,742 Y279F probably damaging Het
Olfr815 T C 10: 129,902,123 M196V probably benign Het
Papolb T C 5: 142,529,178 I237V probably benign Het
Parpbp T A 10: 88,093,702 Q428L possibly damaging Het
Pclo T C 5: 14,669,271 S1141P unknown Het
Plcb1 T C 2: 135,335,493 S582P probably benign Het
Ppargc1a C T 5: 51,463,215 probably benign Het
Ptchd4 A T 17: 42,502,455 I416L probably benign Het
Rhpn1 G A 15: 75,714,119 R627H probably benign Het
Ric8a G A 7: 140,861,337 G182S probably damaging Het
Rims1 T C 1: 22,373,494 D895G probably damaging Het
Rrp1b G A 17: 32,056,010 probably benign Het
Rtf1 T A 2: 119,730,729 D636E probably benign Het
Scn3a T C 2: 65,524,179 D333G probably benign Het
Sema6a A G 18: 47,291,923 L207P probably damaging Het
Shcbp1 A T 8: 4,749,779 Y160* probably null Het
Slc27a1 A T 8: 71,580,066 probably null Het
Ston2 C T 12: 91,641,872 R818Q probably damaging Het
Tipin T A 9: 64,288,103 probably null Het
Vmn1r117 A T 7: 20,883,592 F177Y probably damaging Het
Vmn1r57 A G 7: 5,220,668 D64G possibly damaging Het
Vmn2r73 T A 7: 85,875,847 D31V probably benign Het
Vmn2r-ps41 A T 7: 9,177,064 noncoding transcript Het
Other mutations in Tjap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
I0000:Tjap1 UTSW 17 46259029 missense probably damaging 1.00
PIT4519001:Tjap1 UTSW 17 46261506 missense probably benign 0.09
R0087:Tjap1 UTSW 17 46263726 missense probably damaging 1.00
R0930:Tjap1 UTSW 17 46258529 missense possibly damaging 0.94
R1513:Tjap1 UTSW 17 46261442 missense probably benign 0.01
R1885:Tjap1 UTSW 17 46262421 missense probably damaging 1.00
R2518:Tjap1 UTSW 17 46260095 missense probably damaging 1.00
R4523:Tjap1 UTSW 17 46258792 missense probably benign
R5452:Tjap1 UTSW 17 46260175 missense probably damaging 0.99
R5590:Tjap1 UTSW 17 46258871 missense probably damaging 1.00
R6600:Tjap1 UTSW 17 46259998 missense probably damaging 1.00
R7015:Tjap1 UTSW 17 46263774 missense possibly damaging 0.87
R7790:Tjap1 UTSW 17 46258690 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATACTGCCTCCTCAGACTG -3'
(R):5'- GCCTCAGATCAAGAAGGCTG -3'

Sequencing Primer
(F):5'- TCCTCAGACTGGAGAGCG -3'
(R):5'- CCTCAGATCAAGAAGGCTGAGATG -3'
Posted On2015-08-18