Mutagenetix > Incidental Mutations

Incidental Mutation 'R4518:Adamtsl2'

334047

Institutional Source

Beutler Lab

Gene Symbol

Adamtsl2

Ensembl Gene

ENSMUSG00000036040

Gene Name

ADAMTS-like 2

Synonyms

A930008K15Rik

MMRRC Submission

041762-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4518 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

27079379-27108981 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 27095547 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 481 (L481P)

Ref Sequence

ENSEMBL: ENSMUSP00000088774 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091233]

Predicted Effect

probably benign
Transcript: ENSMUST00000091233
AA Change: L481P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000088774
Gene: ENSMUSG00000036040
AA Change: L481P

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
TSP1	50	106	5.14e-7	SMART
Pfam:ADAM_spacer1	214	331	5.4e-28	PFAM
low complexity region	345	358	N/A	INTRINSIC
TSP1	573	629	8.15e-1	SMART
TSP1	631	692	1.85e-2	SMART
TSP1	694	744	4.15e-1	SMART
TSP1	747	796	9.98e-5	SMART
TSP1	803	861	4.95e-2	SMART
TSP1	863	914	2.53e-6	SMART
Pfam:PLAC	922	953	1.4e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143246

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000169787

Meta Mutation Damage Score

0.2536

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

98% (60/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) and ADAMTS-like protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The protein encoded by this gene lacks the protease domain, and is therefore of a member of the the ADAMTS-like protein subfamily. It is a secreted glycoprotein that binds the cell surface and extracellular matrix; it also interacts with latent transforming growth factor beta binding protein 1. Mutations in this gene have been associated with geleophysic dysplasia. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygous null mice die shortly after birth, are cyanotic and exhibit respiratory distress. Severe bronchial epithelial dysplasia with abnormal glycogen-rich inclusions in the bronchial epithelium is observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110082J24Rik	T	A	5: 30,106,008		probably null	Het
Abr	A	G	11: 76,472,518	S167P	possibly damaging	Het
Atp8b3	C	T	10: 80,523,847	M984I	probably benign	Het
Brip1	G	A	11: 86,077,878	A827V	possibly damaging	Het
Carns1	T	G	19: 4,170,070	T389P	probably benign	Het
Ccdc88a	T	C	11: 29,482,651	I1219T	probably benign	Het
Cckar	T	C	5: 53,699,922	N311S	probably damaging	Het
Cenpc1	A	G	5: 86,047,587	S108P	possibly damaging	Het
Chpf	G	T	1: 75,475,045	S588R	probably damaging	Het
Clca3a2	T	A	3: 144,808,705	T414S	probably damaging	Het
Cntrl	A	G	2: 35,148,974	E1092G	probably damaging	Het
Crb2	C	A	2: 37,790,389	T443K	probably damaging	Het
Cwf19l1	A	G	19: 44,133,034	V25A	probably damaging	Het
Cyb561d1	T	C	3: 108,199,571	I111V	possibly damaging	Het
Dbn1	A	T	13: 55,476,229	I350N	possibly damaging	Het
Dnajb4	T	C	3: 152,185,176	I329V	probably benign	Het
Dnmt1	G	T	9: 20,911,978	D1055E	probably benign	Het
Fam122c	G	A	X: 53,293,499	R94H	possibly damaging	Het
Fam168a	C	T	7: 100,834,040	A176V	probably damaging	Het
Farp2	A	G	1: 93,620,641	E1016G	probably benign	Het
Fibcd1	A	T	2: 31,817,195	V350E	probably damaging	Het
Galnt3	C	A	2: 66,093,610	R438L	probably damaging	Het
Golga4	T	A	9: 118,559,008	S1733T	probably benign	Het
Golgb1	G	A	16: 36,929,263	E3076K	probably damaging	Het
Grm7	A	G	6: 110,914,546		probably null	Het
Hcn2	T	C	10: 79,724,702	V289A	probably benign	Het
Hipk1	G	T	3: 103,750,372	H799N	probably damaging	Het
Ispd	G	A	12: 36,473,180	V203I	possibly damaging	Het
Klf14	A	G	6: 30,957,932	S256P	possibly damaging	Het
Muc6	T	A	7: 141,644,222	T1214S	probably benign	Het
Nlrp2	T	A	7: 5,325,056	D666V	possibly damaging	Het
Ntng1	A	G	3: 109,935,013	I148T	probably damaging	Het
Olfr1277	T	C	2: 111,269,918	M150V	probably benign	Het
Olfr39	A	G	9: 20,286,250	I184V	probably benign	Het
Olfr845	T	A	9: 19,339,260	S267T	possibly damaging	Het
Orc4	G	A	2: 48,937,489	P31S	probably benign	Het
Pacs2	A	G	12: 113,060,669	D360G	probably benign	Het
Parp8	C	A	13: 116,895,673	L321F	possibly damaging	Het
Pdss2	T	A	10: 43,372,150	S217T	probably damaging	Het
Plekhn1	T	C	4: 156,225,531	S109G	probably damaging	Het
Ppil2	A	T	16: 17,096,041	F173I	possibly damaging	Het
Prlr	C	A	15: 10,328,999	T520K	possibly damaging	Het
Prokr2	T	A	2: 132,374,092		probably null	Het
Rab3gap2	G	A	1: 185,267,068	V991I	probably benign	Het
Reln	T	C	5: 21,901,743	I3210V	probably benign	Het
Rims2	T	C	15: 39,437,526	Y218H	probably damaging	Het
Slc41a1	T	C	1: 131,839,125	V127A	probably damaging	Het
St8sia6	T	A	2: 13,792,751		probably null	Het
Tlr6	A	G	5: 64,954,904	F220S	possibly damaging	Het
Trmt1l	C	T	1: 151,448,343	Q314*	probably null	Het
Ubqlnl	C	T	7: 104,149,718	V191M	probably benign	Het
Vnn3	G	A	10: 23,867,226	V445M	possibly damaging	Het
Zfhx4	T	C	3: 5,412,518	C3398R	probably damaging	Het
Zfyve16	T	C	13: 92,521,312	E697G	possibly damaging	Het

Other mutations in Adamtsl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00423:Adamtsl2	APN	2	27085088	missense	probably damaging	1.00
IGL01902:Adamtsl2	APN	2	27087252	missense	probably damaging	1.00
IGL02207:Adamtsl2	APN	2	27102981	missense	probably damaging	0.99
IGL02247:Adamtsl2	APN	2	27084893	missense	probably damaging	1.00
IGL02253:Adamtsl2	APN	2	27098697	missense	possibly damaging	0.48
IGL02655:Adamtsl2	APN	2	27082530	splice site	probably benign
IGL03148:Adamtsl2	APN	2	27084059	missense	probably damaging	0.99
IGL03269:Adamtsl2	APN	2	27108355	nonsense	probably null
R0609:Adamtsl2	UTSW	2	27089635	missense	probably benign	0.25
R1183:Adamtsl2	UTSW	2	27084080	missense	probably damaging	1.00
R1443:Adamtsl2	UTSW	2	27103066	missense	possibly damaging	0.89
R1675:Adamtsl2	UTSW	2	27082485	frame shift	probably null
R1698:Adamtsl2	UTSW	2	27103127	missense	possibly damaging	0.92
R1765:Adamtsl2	UTSW	2	27102830	missense	probably benign	0.01
R1934:Adamtsl2	UTSW	2	27089593	missense	probably damaging	0.99
R2106:Adamtsl2	UTSW	2	27102825	missense	probably benign	0.02
R2108:Adamtsl2	UTSW	2	27095558	missense	probably benign
R2189:Adamtsl2	UTSW	2	27081738	missense	probably benign	0.00
R2232:Adamtsl2	UTSW	2	27103178	missense	probably damaging	1.00
R4301:Adamtsl2	UTSW	2	27087283	missense	probably null	1.00
R4572:Adamtsl2	UTSW	2	27083256	missense	probably damaging	0.99
R4627:Adamtsl2	UTSW	2	27093585	missense	probably damaging	0.99
R4668:Adamtsl2	UTSW	2	27095475	missense	probably benign	0.00
R4686:Adamtsl2	UTSW	2	27093825	missense	probably damaging	0.99
R4821:Adamtsl2	UTSW	2	27098592	splice site	probably null
R5054:Adamtsl2	UTSW	2	27101720	missense	probably damaging	1.00
R5460:Adamtsl2	UTSW	2	27095398	splice site	probably null
R5569:Adamtsl2	UTSW	2	27102833	missense	probably damaging	1.00
R5694:Adamtsl2	UTSW	2	27081724	missense	probably benign	0.03
R6836:Adamtsl2	UTSW	2	27081706	start codon destroyed	probably null	0.90
R7103:Adamtsl2	UTSW	2	27107461	missense	probably damaging	1.00
R7437:Adamtsl2	UTSW	2	27089709	missense	probably damaging	0.99
X0003:Adamtsl2	UTSW	2	27081772	small deletion	probably benign
X0003:Adamtsl2	UTSW	2	27081773	small deletion	probably benign

Predicted Primers

PCR Primer
(F):5'- TCAACACAAGAGCAGCATGG -3'
(R):5'- TCCTGTTCCCAGCCAAGTTG -3'

Sequencing Primer
(F):5'- CATGGCTGTTGAAACACCTG -3'
(R):5'- GCACTGGTGTTGGGGAATG -3'

Posted On

2015-08-18