Incidental Mutation 'R4518:Cntrl'
ID334049
Institutional Source Beutler Lab
Gene Symbol Cntrl
Ensembl Gene ENSMUSG00000057110
Gene Namecentriolin
Synonyms6720467O09Rik, Cep110, IB3/5, Ma2a8, b2b1468Clo, Cep1
MMRRC Submission 041762-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.893) question?
Stock #R4518 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location35109492-35178822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35148974 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1092 (E1092G)
Ref Sequence ENSEMBL: ENSMUSP00000118731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028237] [ENSMUST00000113032] [ENSMUST00000113033] [ENSMUST00000113034] [ENSMUST00000113037] [ENSMUST00000156933] [ENSMUST00000201787]
Predicted Effect probably damaging
Transcript: ENSMUST00000028237
AA Change: E1092G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028237
Gene: ENSMUSG00000057110
AA Change: E1092G

DomainStartEndE-ValueType
low complexity region 21 38 N/A INTRINSIC
LRR 146 167 2.54e1 SMART
LRR 168 190 3.24e0 SMART
LRR 192 214 7.16e0 SMART
Blast:LRR 217 239 8e-6 BLAST
low complexity region 275 292 N/A INTRINSIC
coiled coil region 437 800 N/A INTRINSIC
coiled coil region 858 971 N/A INTRINSIC
low complexity region 975 995 N/A INTRINSIC
coiled coil region 998 1102 N/A INTRINSIC
internal_repeat_1 1119 1132 1.95e-5 PROSPERO
low complexity region 1153 1161 N/A INTRINSIC
low complexity region 1268 1301 N/A INTRINSIC
coiled coil region 1320 1629 N/A INTRINSIC
coiled coil region 1661 2155 N/A INTRINSIC
low complexity region 2193 2208 N/A INTRINSIC
internal_repeat_1 2252 2265 1.95e-5 PROSPERO
low complexity region 2289 2307 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113032
AA Change: E1091G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108655
Gene: ENSMUSG00000057110
AA Change: E1091G

DomainStartEndE-ValueType
low complexity region 20 53 N/A INTRINSIC
coiled coil region 72 381 N/A INTRINSIC
coiled coil region 413 907 N/A INTRINSIC
low complexity region 945 960 N/A INTRINSIC
coiled coil region 989 1011 N/A INTRINSIC
low complexity region 1041 1059 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113033
SMART Domains Protein: ENSMUSP00000108656
Gene: ENSMUSG00000057110

DomainStartEndE-ValueType
coiled coil region 1 247 N/A INTRINSIC
coiled coil region 305 418 N/A INTRINSIC
low complexity region 422 442 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113034
AA Change: E539G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108657
Gene: ENSMUSG00000057110
AA Change: E539G

DomainStartEndE-ValueType
coiled coil region 1 247 N/A INTRINSIC
internal_repeat_3 261 278 5.68e-5 PROSPERO
coiled coil region 305 418 N/A INTRINSIC
low complexity region 422 442 N/A INTRINSIC
coiled coil region 445 549 N/A INTRINSIC
internal_repeat_1 566 579 1.52e-6 PROSPERO
internal_repeat_2 568 596 2.75e-5 PROSPERO
low complexity region 600 608 N/A INTRINSIC
internal_repeat_2 626 653 2.75e-5 PROSPERO
low complexity region 715 748 N/A INTRINSIC
coiled coil region 767 1076 N/A INTRINSIC
internal_repeat_3 1095 1112 5.68e-5 PROSPERO
low complexity region 1184 1224 N/A INTRINSIC
low complexity region 1344 1356 N/A INTRINSIC
low complexity region 1366 1388 N/A INTRINSIC
low complexity region 1400 1415 N/A INTRINSIC
low complexity region 1421 1432 N/A INTRINSIC
low complexity region 1640 1655 N/A INTRINSIC
internal_repeat_1 1699 1712 1.52e-6 PROSPERO
low complexity region 1736 1754 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113037
AA Change: E538G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108660
Gene: ENSMUSG00000057110
AA Change: E538G

DomainStartEndE-ValueType
coiled coil region 1 247 N/A INTRINSIC
internal_repeat_3 261 278 5.34e-5 PROSPERO
coiled coil region 305 548 N/A INTRINSIC
internal_repeat_1 565 578 1.42e-6 PROSPERO
internal_repeat_2 567 595 2.58e-5 PROSPERO
low complexity region 599 607 N/A INTRINSIC
internal_repeat_2 625 652 2.58e-5 PROSPERO
low complexity region 714 747 N/A INTRINSIC
coiled coil region 766 1075 N/A INTRINSIC
internal_repeat_3 1094 1111 5.34e-5 PROSPERO
low complexity region 1183 1223 N/A INTRINSIC
low complexity region 1343 1355 N/A INTRINSIC
low complexity region 1365 1387 N/A INTRINSIC
low complexity region 1399 1414 N/A INTRINSIC
low complexity region 1420 1431 N/A INTRINSIC
low complexity region 1639 1654 N/A INTRINSIC
internal_repeat_1 1698 1711 1.42e-6 PROSPERO
low complexity region 1735 1753 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123884
SMART Domains Protein: ENSMUSP00000119760
Gene: ENSMUSG00000057110

DomainStartEndE-ValueType
coiled coil region 37 400 N/A INTRINSIC
coiled coil region 458 571 N/A INTRINSIC
low complexity region 576 596 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000156933
AA Change: E1092G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118731
Gene: ENSMUSG00000057110
AA Change: E1092G

DomainStartEndE-ValueType
low complexity region 21 38 N/A INTRINSIC
LRR 146 167 2.54e1 SMART
LRR 168 190 3.24e0 SMART
LRR 192 214 7.16e0 SMART
Blast:LRR 217 239 7e-6 BLAST
low complexity region 275 292 N/A INTRINSIC
coiled coil region 437 800 N/A INTRINSIC
coiled coil region 858 971 N/A INTRINSIC
low complexity region 975 995 N/A INTRINSIC
coiled coil region 998 1102 N/A INTRINSIC
internal_repeat_1 1119 1132 1.65e-5 PROSPERO
low complexity region 1153 1161 N/A INTRINSIC
low complexity region 1268 1301 N/A INTRINSIC
coiled coil region 1320 1629 N/A INTRINSIC
coiled coil region 1661 2155 N/A INTRINSIC
low complexity region 2193 2208 N/A INTRINSIC
internal_repeat_1 2252 2265 1.65e-5 PROSPERO
low complexity region 2289 2307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201787
SMART Domains Protein: ENSMUSP00000143914
Gene: ENSMUSG00000057110

DomainStartEndE-ValueType
coiled coil region 9 71 N/A INTRINSIC
Meta Mutation Damage Score 0.0764 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein required for the centrosome to function as a microtubule organizing center. The gene product is also associated with centrosome maturation. One version of stem cell myeloproliferative disorder is the result of a reciprocal translocation between chromosomes 8 and 9, with the breakpoint associated with fibroblast growth factor receptor 1 and centrosomal protein 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit cardiac defects, including double outlet right ventricle, atrial septal defects, ventricular septal defects, tricuspid valve stenosis and heart right ventricle hypoplasia, and develop kidney cysts and hydronephrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082J24Rik T A 5: 30,106,008 probably null Het
Abr A G 11: 76,472,518 S167P possibly damaging Het
Adamtsl2 T C 2: 27,095,547 L481P probably benign Het
Atp8b3 C T 10: 80,523,847 M984I probably benign Het
Brip1 G A 11: 86,077,878 A827V possibly damaging Het
Carns1 T G 19: 4,170,070 T389P probably benign Het
Ccdc88a T C 11: 29,482,651 I1219T probably benign Het
Cckar T C 5: 53,699,922 N311S probably damaging Het
Cenpc1 A G 5: 86,047,587 S108P possibly damaging Het
Chpf G T 1: 75,475,045 S588R probably damaging Het
Clca3a2 T A 3: 144,808,705 T414S probably damaging Het
Crb2 C A 2: 37,790,389 T443K probably damaging Het
Cwf19l1 A G 19: 44,133,034 V25A probably damaging Het
Cyb561d1 T C 3: 108,199,571 I111V possibly damaging Het
Dbn1 A T 13: 55,476,229 I350N possibly damaging Het
Dnajb4 T C 3: 152,185,176 I329V probably benign Het
Dnmt1 G T 9: 20,911,978 D1055E probably benign Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fam168a C T 7: 100,834,040 A176V probably damaging Het
Farp2 A G 1: 93,620,641 E1016G probably benign Het
Fibcd1 A T 2: 31,817,195 V350E probably damaging Het
Galnt3 C A 2: 66,093,610 R438L probably damaging Het
Golga4 T A 9: 118,559,008 S1733T probably benign Het
Golgb1 G A 16: 36,929,263 E3076K probably damaging Het
Grm7 A G 6: 110,914,546 probably null Het
Hcn2 T C 10: 79,724,702 V289A probably benign Het
Hipk1 G T 3: 103,750,372 H799N probably damaging Het
Ispd G A 12: 36,473,180 V203I possibly damaging Het
Klf14 A G 6: 30,957,932 S256P possibly damaging Het
Muc6 T A 7: 141,644,222 T1214S probably benign Het
Nlrp2 T A 7: 5,325,056 D666V possibly damaging Het
Ntng1 A G 3: 109,935,013 I148T probably damaging Het
Olfr1277 T C 2: 111,269,918 M150V probably benign Het
Olfr39 A G 9: 20,286,250 I184V probably benign Het
Olfr845 T A 9: 19,339,260 S267T possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pacs2 A G 12: 113,060,669 D360G probably benign Het
Parp8 C A 13: 116,895,673 L321F possibly damaging Het
Pdss2 T A 10: 43,372,150 S217T probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Ppil2 A T 16: 17,096,041 F173I possibly damaging Het
Prlr C A 15: 10,328,999 T520K possibly damaging Het
Prokr2 T A 2: 132,374,092 probably null Het
Rab3gap2 G A 1: 185,267,068 V991I probably benign Het
Reln T C 5: 21,901,743 I3210V probably benign Het
Rims2 T C 15: 39,437,526 Y218H probably damaging Het
Slc41a1 T C 1: 131,839,125 V127A probably damaging Het
St8sia6 T A 2: 13,792,751 probably null Het
Tlr6 A G 5: 64,954,904 F220S possibly damaging Het
Trmt1l C T 1: 151,448,343 Q314* probably null Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vnn3 G A 10: 23,867,226 V445M possibly damaging Het
Zfhx4 T C 3: 5,412,518 C3398R probably damaging Het
Zfyve16 T C 13: 92,521,312 E697G possibly damaging Het
Other mutations in Cntrl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Cntrl APN 2 35137814 splice site probably benign
IGL00478:Cntrl APN 2 35160601 missense probably damaging 0.98
IGL01460:Cntrl APN 2 35165844 missense probably benign 0.04
IGL01556:Cntrl APN 2 35173059 missense probably benign 0.19
IGL02155:Cntrl APN 2 35160238 splice site probably benign
IGL02419:Cntrl APN 2 35134043 missense probably damaging 0.97
PIT4480001:Cntrl UTSW 2 35155428 missense probably damaging 0.96
R0179:Cntrl UTSW 2 35167859 missense probably benign 0.00
R0276:Cntrl UTSW 2 35151732 missense possibly damaging 0.62
R0471:Cntrl UTSW 2 35127380 missense probably benign 0.41
R0755:Cntrl UTSW 2 35145139 missense probably damaging 1.00
R0763:Cntrl UTSW 2 35171066 missense probably benign
R0781:Cntrl UTSW 2 35160627 missense possibly damaging 0.66
R0791:Cntrl UTSW 2 35155279 missense possibly damaging 0.83
R0792:Cntrl UTSW 2 35155279 missense possibly damaging 0.83
R0801:Cntrl UTSW 2 35175095 splice site probably benign
R1067:Cntrl UTSW 2 35149022 unclassified probably benign
R1110:Cntrl UTSW 2 35160627 missense possibly damaging 0.66
R1117:Cntrl UTSW 2 35127973 missense probably damaging 1.00
R1457:Cntrl UTSW 2 35122756 missense probably benign 0.00
R1472:Cntrl UTSW 2 35169317 critical splice donor site probably null
R1522:Cntrl UTSW 2 35155279 missense possibly damaging 0.83
R1702:Cntrl UTSW 2 35171836 critical splice acceptor site probably null
R1762:Cntrl UTSW 2 35122806 frame shift probably null
R1785:Cntrl UTSW 2 35122806 frame shift probably null
R1786:Cntrl UTSW 2 35122806 frame shift probably null
R1812:Cntrl UTSW 2 35149469 missense probably damaging 0.97
R1854:Cntrl UTSW 2 35122684 missense probably damaging 1.00
R1863:Cntrl UTSW 2 35118119 missense possibly damaging 0.93
R1868:Cntrl UTSW 2 35129815 missense probably benign 0.03
R1914:Cntrl UTSW 2 35162861 missense probably benign 0.00
R1915:Cntrl UTSW 2 35162861 missense probably benign 0.00
R2049:Cntrl UTSW 2 35122806 frame shift probably null
R2118:Cntrl UTSW 2 35161965 missense probably benign 0.31
R2140:Cntrl UTSW 2 35122806 frame shift probably null
R2142:Cntrl UTSW 2 35122806 frame shift probably null
R2203:Cntrl UTSW 2 35143737 missense possibly damaging 0.84
R2300:Cntrl UTSW 2 35127513 missense probably benign 0.00
R2349:Cntrl UTSW 2 35176251 missense probably benign 0.18
R2374:Cntrl UTSW 2 35153276 missense possibly damaging 0.46
R3429:Cntrl UTSW 2 35145100 missense probably damaging 1.00
R3890:Cntrl UTSW 2 35170480 missense probably benign 0.02
R3911:Cntrl UTSW 2 35120049 missense probably damaging 1.00
R3922:Cntrl UTSW 2 35129739 missense probably damaging 0.98
R4081:Cntrl UTSW 2 35161926 splice site probably benign
R4081:Cntrl UTSW 2 35175125 missense probably damaging 1.00
R4516:Cntrl UTSW 2 35127981 missense probably benign 0.00
R4519:Cntrl UTSW 2 35173111 missense probably damaging 1.00
R4646:Cntrl UTSW 2 35149461 missense probably damaging 0.99
R4753:Cntrl UTSW 2 35153439 missense possibly damaging 0.90
R4763:Cntrl UTSW 2 35175551 missense probably damaging 1.00
R4916:Cntrl UTSW 2 35165682 missense probably benign 0.42
R5168:Cntrl UTSW 2 35157655 missense probably damaging 1.00
R5291:Cntrl UTSW 2 35134060 missense probably damaging 1.00
R5356:Cntrl UTSW 2 35148899 nonsense probably null
R5774:Cntrl UTSW 2 35162861 missense probably benign 0.15
R5947:Cntrl UTSW 2 35116679 missense probably damaging 1.00
R6144:Cntrl UTSW 2 35165733 missense possibly damaging 0.93
R6147:Cntrl UTSW 2 35165733 missense possibly damaging 0.93
R6214:Cntrl UTSW 2 35129634 missense probably benign 0.10
R6267:Cntrl UTSW 2 35129793 missense probably damaging 1.00
R6332:Cntrl UTSW 2 35128024 missense possibly damaging 0.78
R6445:Cntrl UTSW 2 35162848 missense probably benign 0.05
R6487:Cntrl UTSW 2 35122682 missense possibly damaging 0.89
R6497:Cntrl UTSW 2 35135572 missense possibly damaging 0.66
R6782:Cntrl UTSW 2 35170646 missense possibly damaging 0.75
R6815:Cntrl UTSW 2 35149491 missense probably damaging 1.00
R6853:Cntrl UTSW 2 35129821 missense possibly damaging 0.87
R6858:Cntrl UTSW 2 35162095 critical splice donor site probably null
R6965:Cntrl UTSW 2 35162833 missense probably benign 0.20
R6970:Cntrl UTSW 2 35118137 missense probably benign
R7085:Cntrl UTSW 2 35165792 missense probably benign 0.00
R7150:Cntrl UTSW 2 35165445 critical splice acceptor site probably null
R7213:Cntrl UTSW 2 35135680 missense possibly damaging 0.95
R7221:Cntrl UTSW 2 35151857 missense possibly damaging 0.46
R7389:Cntrl UTSW 2 35127517 missense probably benign 0.01
R7414:Cntrl UTSW 2 35165467 missense probably benign 0.02
R7427:Cntrl UTSW 2 35170534 missense probably benign 0.00
R7428:Cntrl UTSW 2 35170534 missense probably benign 0.00
R7453:Cntrl UTSW 2 35155409 missense possibly damaging 0.89
R7747:Cntrl UTSW 2 35116798 missense probably damaging 1.00
R7753:Cntrl UTSW 2 35111679 missense probably damaging 1.00
R7811:Cntrl UTSW 2 35162861 missense probably benign 0.00
R7882:Cntrl UTSW 2 35170580 missense probably benign 0.41
R7965:Cntrl UTSW 2 35170580 missense probably benign 0.41
RF007:Cntrl UTSW 2 35170500 missense probably benign
RF016:Cntrl UTSW 2 35119986 missense probably benign
RF017:Cntrl UTSW 2 35175189 missense probably damaging 0.96
X0024:Cntrl UTSW 2 35147296 missense probably damaging 1.00
X0026:Cntrl UTSW 2 35149516 missense probably damaging 1.00
X0027:Cntrl UTSW 2 35157768 missense probably damaging 1.00
X0027:Cntrl UTSW 2 35165682 missense probably benign 0.08
X0028:Cntrl UTSW 2 35147344 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TGAAAGGGGTAAGATGGTTTCCTC -3'
(R):5'- AGCCATGACTCTCTAGATCAGGC -3'

Sequencing Primer
(F):5'- AGATGGTTTCCTCATTGGTAAAAAG -3'
(R):5'- CATGGAGTTGACTTCCTCAGCTAAG -3'
Posted On2015-08-18