Incidental Mutation 'R4518:Dnajb4'
ID 334060
Institutional Source Beutler Lab
Gene Symbol Dnajb4
Ensembl Gene ENSMUSG00000028035
Gene Name DnaJ heat shock protein family (Hsp40) member B4
Synonyms 5730460G06Rik, 2010306G19Rik, 1700029A20Rik
MMRRC Submission 041762-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.209) question?
Stock # R4518 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 151887217-151915720 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 151890813 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 329 (I329V)
Ref Sequence ENSEMBL: ENSMUSP00000114356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029669] [ENSMUST00000050073] [ENSMUST00000144950]
AlphaFold Q9D832
Predicted Effect probably benign
Transcript: ENSMUST00000029669
AA Change: I329V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029669
Gene: ENSMUSG00000028035
AA Change: I329V

DomainStartEndE-ValueType
DnaJ 3 60 4.9e-31 SMART
low complexity region 68 84 N/A INTRINSIC
Pfam:DnaJ_C 160 319 1.9e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000050073
AA Change: I329V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000053916
Gene: ENSMUSG00000028035
AA Change: I329V

DomainStartEndE-ValueType
DnaJ 3 60 4.9e-31 SMART
low complexity region 68 84 N/A INTRINSIC
Pfam:CTDII 249 329 1.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134701
Predicted Effect probably benign
Transcript: ENSMUST00000144950
AA Change: I329V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114356
Gene: ENSMUSG00000028035
AA Change: I329V

DomainStartEndE-ValueType
DnaJ 3 60 4.9e-31 SMART
low complexity region 68 84 N/A INTRINSIC
Pfam:CTDII 249 329 1.1e-21 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a molecular chaperone, tumor suppressor, and member of the heat shock protein-40 family. The encoded protein binds the cell adhesion protein E-cadherin and targets it to the plasma membrane. This protein also binds incorrectly folded E-cadherin and targets it for endoplasmic reticulum-associated degradation. This gene is a strong tumor suppressor for colorectal carcinoma, and downregulation of it may serve as a good biomarker for predicting patient outcomes. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082J24Rik T A 5: 30,311,006 (GRCm39) probably null Het
Abr A G 11: 76,363,344 (GRCm39) S167P possibly damaging Het
Adamtsl2 T C 2: 26,985,559 (GRCm39) L481P probably benign Het
Atp8b3 C T 10: 80,359,681 (GRCm39) M984I probably benign Het
Brip1 G A 11: 85,968,704 (GRCm39) A827V possibly damaging Het
Carns1 T G 19: 4,220,069 (GRCm39) T389P probably benign Het
Ccdc88a T C 11: 29,432,651 (GRCm39) I1219T probably benign Het
Cckar T C 5: 53,857,264 (GRCm39) N311S probably damaging Het
Cenpc1 A G 5: 86,195,446 (GRCm39) S108P possibly damaging Het
Chpf G T 1: 75,451,689 (GRCm39) S588R probably damaging Het
Clca3a2 T A 3: 144,514,466 (GRCm39) T414S probably damaging Het
Cntrl A G 2: 35,038,986 (GRCm39) E1092G probably damaging Het
Crb2 C A 2: 37,680,401 (GRCm39) T443K probably damaging Het
Crppa G A 12: 36,523,179 (GRCm39) V203I possibly damaging Het
Cwf19l1 A G 19: 44,121,473 (GRCm39) V25A probably damaging Het
Cyb561d1 T C 3: 108,106,887 (GRCm39) I111V possibly damaging Het
Dbn1 A T 13: 55,624,042 (GRCm39) I350N possibly damaging Het
Dnmt1 G T 9: 20,823,274 (GRCm39) D1055E probably benign Het
Fam168a C T 7: 100,483,247 (GRCm39) A176V probably damaging Het
Farp2 A G 1: 93,548,363 (GRCm39) E1016G probably benign Het
Fibcd1 A T 2: 31,707,207 (GRCm39) V350E probably damaging Het
Galnt3 C A 2: 65,923,954 (GRCm39) R438L probably damaging Het
Golga4 T A 9: 118,388,076 (GRCm39) S1733T probably benign Het
Golgb1 G A 16: 36,749,625 (GRCm39) E3076K probably damaging Het
Grm7 A G 6: 110,891,507 (GRCm39) probably null Het
Hcn2 T C 10: 79,560,536 (GRCm39) V289A probably benign Het
Hipk1 G T 3: 103,657,688 (GRCm39) H799N probably damaging Het
Klf14 A G 6: 30,934,867 (GRCm39) S256P possibly damaging Het
Muc6 T A 7: 141,230,489 (GRCm39) T1214S probably benign Het
Nlrp2 T A 7: 5,328,055 (GRCm39) D666V possibly damaging Het
Ntng1 A G 3: 109,842,329 (GRCm39) I148T probably damaging Het
Or4k35 T C 2: 111,100,263 (GRCm39) M150V probably benign Het
Or7d9 A G 9: 20,197,546 (GRCm39) I184V probably benign Het
Or7g27 T A 9: 19,250,556 (GRCm39) S267T possibly damaging Het
Orc4 G A 2: 48,827,501 (GRCm39) P31S probably benign Het
Pabir3 G A X: 52,382,376 (GRCm39) R94H possibly damaging Het
Pacs2 A G 12: 113,024,289 (GRCm39) D360G probably benign Het
Parp8 C A 13: 117,032,209 (GRCm39) L321F possibly damaging Het
Pdss2 T A 10: 43,248,146 (GRCm39) S217T probably damaging Het
Plekhn1 T C 4: 156,309,988 (GRCm39) S109G probably damaging Het
Prlr C A 15: 10,329,085 (GRCm39) T520K possibly damaging Het
Prokr2 T A 2: 132,216,012 (GRCm39) probably null Het
Rab3gap2 G A 1: 184,999,265 (GRCm39) V991I probably benign Het
Reln T C 5: 22,106,741 (GRCm39) I3210V probably benign Het
Rims2 T C 15: 39,300,922 (GRCm39) Y218H probably damaging Het
Slc41a1 T C 1: 131,766,863 (GRCm39) V127A probably damaging Het
St8sia6 T A 2: 13,797,562 (GRCm39) probably null Het
Tlr6 A G 5: 65,112,247 (GRCm39) F220S possibly damaging Het
Trmt1l C T 1: 151,324,094 (GRCm39) Q314* probably null Het
Ubqlnl C T 7: 103,798,925 (GRCm39) V191M probably benign Het
Vnn3 G A 10: 23,743,124 (GRCm39) V445M possibly damaging Het
Ypel1 A T 16: 16,913,905 (GRCm39) F173I possibly damaging Het
Zfhx4 T C 3: 5,477,578 (GRCm39) C3398R probably damaging Het
Zfyve16 T C 13: 92,657,820 (GRCm39) E697G possibly damaging Het
Other mutations in Dnajb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Dnajb4 APN 3 151,899,118 (GRCm39) missense probably damaging 1.00
IGL01960:Dnajb4 APN 3 151,892,176 (GRCm39) missense probably damaging 0.98
IGL03354:Dnajb4 APN 3 151,892,115 (GRCm39) missense probably benign
PIT4418001:Dnajb4 UTSW 3 151,899,134 (GRCm39) missense possibly damaging 0.79
R4471:Dnajb4 UTSW 3 151,890,799 (GRCm39) missense probably benign 0.01
R7711:Dnajb4 UTSW 3 151,892,154 (GRCm39) missense probably benign 0.00
R7947:Dnajb4 UTSW 3 151,892,468 (GRCm39) missense probably benign
R8117:Dnajb4 UTSW 3 151,899,089 (GRCm39) nonsense probably null
R9342:Dnajb4 UTSW 3 151,892,272 (GRCm39) missense probably benign 0.22
R9746:Dnajb4 UTSW 3 151,892,320 (GRCm39) missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- CCACGTTGCCTATTTGAACTGTG -3'
(R):5'- ATTTGGTCCACTTTAGGCATTG -3'

Sequencing Primer
(F):5'- GTCTATTCATGCAGTTTAATGAGCCC -3'
(R):5'- CTGCTCACTTAATGTGCCAACAATG -3'
Posted On 2015-08-18