Incidental Mutation 'R4518:Cckar'
ID334063
Institutional Source Beutler Lab
Gene Symbol Cckar
Ensembl Gene ENSMUSG00000029193
Gene Namecholecystokinin A receptor
Synonyms
MMRRC Submission 041762-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R4518 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location53697776-53707705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53699922 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 311 (N311S)
Ref Sequence ENSEMBL: ENSMUSP00000144103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031093] [ENSMUST00000200691]
Predicted Effect probably damaging
Transcript: ENSMUST00000031093
AA Change: N382S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031093
Gene: ENSMUSG00000029193
AA Change: N382S

DomainStartEndE-ValueType
Pfam:CholecysA-Rec_N 1 47 8.8e-29 PFAM
Pfam:7tm_4 48 252 7.2e-12 PFAM
Pfam:7TM_GPCR_Srsx 52 393 2.6e-10 PFAM
Pfam:7tm_1 58 378 1.1e-66 PFAM
low complexity region 399 416 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200691
AA Change: N311S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144103
Gene: ENSMUSG00000029193
AA Change: N311S

DomainStartEndE-ValueType
Pfam:7tm_1 1 307 1.6e-59 PFAM
Pfam:7tm_4 3 181 1.8e-6 PFAM
low complexity region 328 345 N/A INTRINSIC
Meta Mutation Damage Score 0.3075 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G-protein coupled receptor that binds non-sulfated members of the cholecystokinin (CCK) family of peptide hormones. This receptor is a major physiologic mediator of pancreatic enzyme secretion and smooth muscle contraction of the gallbladder and stomach. In the central and peripheral nervous system this receptor regulates satiety and the release of beta-endorphin and dopamine. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice cannot regulate core body temperature in response to changes in ambient temperature. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082J24Rik T A 5: 30,106,008 probably null Het
Abr A G 11: 76,472,518 S167P possibly damaging Het
Adamtsl2 T C 2: 27,095,547 L481P probably benign Het
Atp8b3 C T 10: 80,523,847 M984I probably benign Het
Brip1 G A 11: 86,077,878 A827V possibly damaging Het
Carns1 T G 19: 4,170,070 T389P probably benign Het
Ccdc88a T C 11: 29,482,651 I1219T probably benign Het
Cenpc1 A G 5: 86,047,587 S108P possibly damaging Het
Chpf G T 1: 75,475,045 S588R probably damaging Het
Clca3a2 T A 3: 144,808,705 T414S probably damaging Het
Cntrl A G 2: 35,148,974 E1092G probably damaging Het
Crb2 C A 2: 37,790,389 T443K probably damaging Het
Cwf19l1 A G 19: 44,133,034 V25A probably damaging Het
Cyb561d1 T C 3: 108,199,571 I111V possibly damaging Het
Dbn1 A T 13: 55,476,229 I350N possibly damaging Het
Dnajb4 T C 3: 152,185,176 I329V probably benign Het
Dnmt1 G T 9: 20,911,978 D1055E probably benign Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fam168a C T 7: 100,834,040 A176V probably damaging Het
Farp2 A G 1: 93,620,641 E1016G probably benign Het
Fibcd1 A T 2: 31,817,195 V350E probably damaging Het
Galnt3 C A 2: 66,093,610 R438L probably damaging Het
Golga4 T A 9: 118,559,008 S1733T probably benign Het
Golgb1 G A 16: 36,929,263 E3076K probably damaging Het
Grm7 A G 6: 110,914,546 probably null Het
Hcn2 T C 10: 79,724,702 V289A probably benign Het
Hipk1 G T 3: 103,750,372 H799N probably damaging Het
Ispd G A 12: 36,473,180 V203I possibly damaging Het
Klf14 A G 6: 30,957,932 S256P possibly damaging Het
Muc6 T A 7: 141,644,222 T1214S probably benign Het
Nlrp2 T A 7: 5,325,056 D666V possibly damaging Het
Ntng1 A G 3: 109,935,013 I148T probably damaging Het
Olfr1277 T C 2: 111,269,918 M150V probably benign Het
Olfr39 A G 9: 20,286,250 I184V probably benign Het
Olfr845 T A 9: 19,339,260 S267T possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pacs2 A G 12: 113,060,669 D360G probably benign Het
Parp8 C A 13: 116,895,673 L321F possibly damaging Het
Pdss2 T A 10: 43,372,150 S217T probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Ppil2 A T 16: 17,096,041 F173I possibly damaging Het
Prlr C A 15: 10,328,999 T520K possibly damaging Het
Prokr2 T A 2: 132,374,092 probably null Het
Rab3gap2 G A 1: 185,267,068 V991I probably benign Het
Reln T C 5: 21,901,743 I3210V probably benign Het
Rims2 T C 15: 39,437,526 Y218H probably damaging Het
Slc41a1 T C 1: 131,839,125 V127A probably damaging Het
St8sia6 T A 2: 13,792,751 probably null Het
Tlr6 A G 5: 64,954,904 F220S possibly damaging Het
Trmt1l C T 1: 151,448,343 Q314* probably null Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vnn3 G A 10: 23,867,226 V445M possibly damaging Het
Zfhx4 T C 3: 5,412,518 C3398R probably damaging Het
Zfyve16 T C 13: 92,521,312 E697G possibly damaging Het
Other mutations in Cckar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Cckar APN 5 53699829 missense possibly damaging 0.86
IGL00568:Cckar APN 5 53707301 missense probably benign 0.02
IGL00766:Cckar APN 5 53700036 missense probably damaging 0.99
IGL00960:Cckar APN 5 53701292 missense probably damaging 1.00
IGL02424:Cckar APN 5 53706428 missense possibly damaging 0.63
IGL03002:Cckar APN 5 53702905 missense probably damaging 0.99
R0167:Cckar UTSW 5 53706453 missense probably damaging 1.00
R0302:Cckar UTSW 5 53700299 frame shift probably null
R0366:Cckar UTSW 5 53700165 missense probably benign 0.01
R0391:Cckar UTSW 5 53706253 critical splice donor site probably null
R0981:Cckar UTSW 5 53706290 missense probably damaging 1.00
R1619:Cckar UTSW 5 53700067 missense probably damaging 1.00
R1644:Cckar UTSW 5 53699873 missense probably benign
R1779:Cckar UTSW 5 53699979 missense probably damaging 1.00
R2184:Cckar UTSW 5 53702912 missense probably damaging 0.96
R4290:Cckar UTSW 5 53706497 missense probably benign
R4291:Cckar UTSW 5 53706497 missense probably benign
R4292:Cckar UTSW 5 53706497 missense probably benign
R4294:Cckar UTSW 5 53706497 missense probably benign
R4583:Cckar UTSW 5 53699782 missense probably benign 0.01
R5139:Cckar UTSW 5 53702923 missense probably benign 0.00
R5505:Cckar UTSW 5 53703068 missense probably damaging 1.00
R6207:Cckar UTSW 5 53699844 missense probably benign
R6415:Cckar UTSW 5 53703056 missense probably damaging 1.00
R7127:Cckar UTSW 5 53706475 missense probably damaging 1.00
R7372:Cckar UTSW 5 53707282 missense probably damaging 0.99
X0028:Cckar UTSW 5 53707273 missense probably benign 0.22
X0028:Cckar UTSW 5 53707274 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACCAGGTACAGCTCAGTGG -3'
(R):5'- GAATCAACCGGATCAGGAGC -3'

Sequencing Primer
(F):5'- ACAGCTCAGTGGGGTGG -3'
(R):5'- AGTGGTTCTGCTGCCAAC -3'
Posted On2015-08-18