Mutagenetix > Incidental Mutation

Incidental Mutation 'R0207:Trank1'

33407

Institutional Source

Beutler Lab

Gene Symbol

Trank1

Ensembl Gene

ENSMUSG00000062296

Gene Name

tetratricopeptide repeat and ankyrin repeat containing 1

Synonyms

A230061D21Rik, LOC235639, C030048J01Rik, Lba1

MMRRC Submission

038460-MU

Accession Numbers

Genbank: NM_001164659.1; Ensembl: ENSMUST00000078626

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0207 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

111311739-111395775 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 111366253 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 1115 (T1115I)

Ref Sequence

ENSEMBL: ENSMUSP00000077697 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078626]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000078626
AA Change: T1115I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000077697
Gene: ENSMUSG00000062296
AA Change: T1115I

Domain	Start	End	E-Value	Type
low complexity region	4	30	N/A	INTRINSIC
low complexity region	34	52	N/A	INTRINSIC
low complexity region	113	129	N/A	INTRINSIC
Blast:TPR	144	177	1e-15	BLAST
Blast:TPR	178	209	8e-13	BLAST
Blast:ANK	332	361	1e-6	BLAST
ANK	369	405	5.29e0	SMART
ANK	538	567	2.11e2	SMART
ANK	572	609	7.29e2	SMART
ANK	621	652	1.21e2	SMART
low complexity region	887	895	N/A	INTRINSIC
low complexity region	1152	1172	N/A	INTRINSIC
Blast:AAA	1351	1569	1e-6	BLAST
low complexity region	2166	2177	N/A	INTRINSIC
low complexity region	2395	2411	N/A	INTRINSIC
low complexity region	2636	2649	N/A	INTRINSIC
low complexity region	2966	2983	N/A	INTRINSIC

Meta Mutation Damage Score

0.4481

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.2%
20x: 95.5%

Validation Efficiency

95% (76/80)

Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	A	G	4: 53,086,039	F488S	probably damaging	Het
Acap3	C	T	4: 155,899,424	R116W	probably damaging	Het
Adamts10	C	A	17: 33,545,390	P663T	possibly damaging	Het
Akap12	G	A	10: 4,353,333	G48S	probably damaging	Het
Ankrd7	T	A	6: 18,870,031	M261K	probably benign	Het
Ankzf1	C	A	1: 75,198,304	D599E	possibly damaging	Het
Aox1	T	C	1: 58,105,014	I1278T	possibly damaging	Het
Apcdd1	T	C	18: 62,950,079	Y327H	probably benign	Het
Asxl3	T	A	18: 22,411,496		probably benign	Het
Birc6	C	A	17: 74,662,832		probably benign	Het
Btaf1	T	A	19: 37,009,648	L1714*	probably null	Het
Cacng6	T	A	7: 3,425,004		probably benign	Het
Cdc20b	A	G	13: 113,078,612	D238G	probably damaging	Het
Celf5	T	A	10: 81,470,698	R113W	probably null	Het
Cfap70	C	A	14: 20,412,347	E659D	probably damaging	Het
Clspn	T	A	4: 126,590,598	M1183K	possibly damaging	Het
Dpy19l1	G	A	9: 24,453,891	R275C	probably damaging	Het
Dst	C	T	1: 34,186,935	S1721L	probably benign	Het
Faap100	T	C	11: 120,374,365	T562A	probably damaging	Het
Fam168b	T	C	1: 34,819,688	M133V	probably damaging	Het
Farp2	T	C	1: 93,569,087	I172T	probably damaging	Het
Fer	T	G	17: 63,896,278	S68A	probably damaging	Het
Fmo5	A	G	3: 97,645,681	E315G	probably damaging	Het
Gpr89	A	T	3: 96,871,480	F426I	probably damaging	Het
Hinfp	T	C	9: 44,296,327	I461V	possibly damaging	Het
Hsd11b1	A	T	1: 193,240,248	V167D	probably damaging	Het
Htt	A	G	5: 34,896,908	K2574E	probably benign	Het
I830077J02Rik	A	G	3: 105,926,505	S112P	probably benign	Het
Igf2bp3	T	A	6: 49,105,617	M344L	probably benign	Het
Itch	A	T	2: 155,202,257	Q494L	probably benign	Het
Itga9	T	C	9: 118,769,253		probably benign	Het
Jaml	T	A	9: 45,093,767	D152E	probably benign	Het
Kif22	A	C	7: 127,042,400	M1R	probably null	Het
Kifap3	T	C	1: 163,883,386	Y663H	probably benign	Het
Letm2	T	A	8: 25,578,770	N472I	probably damaging	Het
Mthfr	T	G	4: 148,052,224	V446G	probably damaging	Het
Myh11	T	C	16: 14,211,260	E1206G	possibly damaging	Het
Myo6	G	A	9: 80,288,056	V903I	probably damaging	Het
Myo9b	C	T	8: 71,355,225		probably benign	Het
Nr2f2	G	C	7: 70,360,175	P52R	probably damaging	Het
Nsd3	A	G	8: 25,683,257	N859S	probably benign	Het
Nucb2	C	A	7: 116,536,010	A384E	probably damaging	Het
Ogdhl	C	A	14: 32,342,037		probably null	Het
Olfr119	C	A	17: 37,701,058	C129*	probably null	Het
Olfr1247	G	A	2: 89,609,863	L80F	probably damaging	Het
Olfr1357	T	C	10: 78,611,871	T257A	probably benign	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr381	A	T	11: 73,486,575	L83Q	probably benign	Het
Parp10	C	T	15: 76,242,633	S145N	probably benign	Het
Pigh	A	G	12: 79,083,709		probably benign	Het
Pigo	A	G	4: 43,023,824		probably benign	Het
Pkp4	T	A	2: 59,305,488	V199D	possibly damaging	Het
Polr1e	C	A	4: 45,025,143		probably null	Het
Ppfia3	C	A	7: 45,348,534	R723L	probably damaging	Het
Prex1	C	A	2: 166,585,898	A945S	possibly damaging	Het
Prrt3	A	T	6: 113,495,840	V457E	probably damaging	Het
Rab39	A	G	9: 53,705,971	F49L	possibly damaging	Het
Rrs1	C	A	1: 9,545,762		probably null	Het
Rrs1	G	A	1: 9,545,767	E82K	probably damaging	Het
Serpinb3c	T	C	1: 107,276,992	D8G	probably benign	Het
Slc17a6	A	G	7: 51,646,180		probably benign	Het
Slc24a4	T	A	12: 102,228,951		probably null	Het
Smc1b	C	T	15: 85,123,759	M272I	probably benign	Het
Smc6	T	C	12: 11,283,178		probably benign	Het
Tcf20	T	C	15: 82,855,085	T722A	probably benign	Het
Tesmin	A	T	19: 3,404,088	M141L	probably benign	Het
Tmprss5	T	A	9: 49,113,160	H274Q	possibly damaging	Het
Tns1	C	T	1: 73,937,318		probably null	Het
Tpr	T	C	1: 150,417,427	S868P	possibly damaging	Het
Trmt44	A	T	5: 35,572,917	I203K	possibly damaging	Het
Ulk2	A	T	11: 61,777,785	V1037E	probably benign	Het
Usp43	A	G	11: 67,876,499	Y682H	probably damaging	Het
Vipr2	A	T	12: 116,142,882	Q366L	probably damaging	Het
Vmn1r185	C	A	7: 26,611,589	V164L	possibly damaging	Het
Vmn2r120	C	T	17: 57,525,052	V246I	probably benign	Het
Wdr66	T	C	5: 123,283,447	V182A	probably damaging	Het
Wiz	C	T	17: 32,357,033	G790R	probably damaging	Het
Wnk1	A	T	6: 119,952,733	S1016R	probably damaging	Het
Zc3hav1	A	G	6: 38,311,174	L909S	probably benign	Het
Zfp236	T	A	18: 82,640,227	I637F	probably damaging	Het
Zfp788	G	A	7: 41,649,596	G532D	probably damaging	Het
Zranb1	T	C	7: 132,950,385	I255T	probably damaging	Het

Other mutations in Trank1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Trank1	APN	9	111392609	missense	probably damaging	1.00
IGL00467:Trank1	APN	9	111364666	splice site	probably benign
IGL00569:Trank1	APN	9	111345511	missense	possibly damaging	0.69
IGL00585:Trank1	APN	9	111349290	missense	possibly damaging	0.82
IGL01070:Trank1	APN	9	111366793	missense	probably damaging	1.00
IGL01134:Trank1	APN	9	111391781	missense	probably benign
IGL01154:Trank1	APN	9	111386400	missense	probably benign	0.00
IGL01355:Trank1	APN	9	111365520	missense	possibly damaging	0.94
IGL01407:Trank1	APN	9	111364722	missense	probably damaging	0.99
IGL01410:Trank1	APN	9	111365049	missense	probably benign	0.00
IGL01410:Trank1	APN	9	111365259	missense	probably benign	0.00
IGL01504:Trank1	APN	9	111373544	missense	probably damaging	1.00
IGL01744:Trank1	APN	9	111349363	missense	probably damaging	1.00
IGL02043:Trank1	APN	9	111363960	missense	probably damaging	0.98
IGL02104:Trank1	APN	9	111390712	missense	possibly damaging	0.85
IGL02193:Trank1	APN	9	111367276	missense	probably benign	0.43
IGL02581:Trank1	APN	9	111383125	missense	probably benign	0.00
IGL02630:Trank1	APN	9	111373075	missense	possibly damaging	0.70
IGL02839:Trank1	APN	9	111364756	missense	probably damaging	1.00
IGL02897:Trank1	APN	9	111367517	missense	probably damaging	0.99
IGL03065:Trank1	APN	9	111390293	missense	possibly damaging	0.64
IGL03123:Trank1	APN	9	111367407	missense	probably damaging	1.00
IGL03143:Trank1	APN	9	111366087	missense	probably damaging	1.00
IGL03323:Trank1	APN	9	111352116	missense	probably damaging	1.00
1mM(1):Trank1	UTSW	9	111392981	missense	probably damaging	1.00
PIT4486001:Trank1	UTSW	9	111390107	missense	probably damaging	1.00
PIT4812001:Trank1	UTSW	9	111347912	missense	probably damaging	1.00
R0035:Trank1	UTSW	9	111366776	missense	probably benign	0.00
R0064:Trank1	UTSW	9	111343195	missense	probably damaging	1.00
R0064:Trank1	UTSW	9	111343195	missense	probably damaging	1.00
R0089:Trank1	UTSW	9	111392910	missense	probably benign	0.00
R0255:Trank1	UTSW	9	111366024	missense	possibly damaging	0.92
R0334:Trank1	UTSW	9	111365353	missense	probably benign	0.00
R0334:Trank1	UTSW	9	111392940	missense	probably damaging	1.00
R0383:Trank1	UTSW	9	111391477	missense	probably benign	0.08
R0421:Trank1	UTSW	9	111391839	missense	probably damaging	1.00
R0494:Trank1	UTSW	9	111391293	missense	probably benign	0.19
R0518:Trank1	UTSW	9	111333808	missense	probably damaging	1.00
R0560:Trank1	UTSW	9	111391086	missense	possibly damaging	0.88
R0637:Trank1	UTSW	9	111390441	missense	probably damaging	1.00
R0731:Trank1	UTSW	9	111365488	missense	probably damaging	1.00
R0761:Trank1	UTSW	9	111366613	missense	probably damaging	1.00
R0766:Trank1	UTSW	9	111347469	missense	probably benign	0.45
R0827:Trank1	UTSW	9	111349417	unclassified	probably benign
R1005:Trank1	UTSW	9	111333721	missense	probably benign	0.13
R1108:Trank1	UTSW	9	111365307	missense	probably benign	0.00
R1155:Trank1	UTSW	9	111366970	missense	possibly damaging	0.95
R1470:Trank1	UTSW	9	111343232	missense	possibly damaging	0.91
R1470:Trank1	UTSW	9	111343232	missense	possibly damaging	0.91
R1596:Trank1	UTSW	9	111366290	missense	possibly damaging	0.93
R1601:Trank1	UTSW	9	111373477	missense	probably damaging	1.00
R1751:Trank1	UTSW	9	111391479	missense	probably benign
R1754:Trank1	UTSW	9	111392871	missense	probably benign	0.00
R1767:Trank1	UTSW	9	111391479	missense	probably benign
R1768:Trank1	UTSW	9	111392927	missense	probably damaging	0.96
R1809:Trank1	UTSW	9	111392825	missense	probably benign	0.34
R1912:Trank1	UTSW	9	111390709	missense	probably benign	0.00
R1920:Trank1	UTSW	9	111347928	critical splice donor site	probably null
R1960:Trank1	UTSW	9	111391628	missense	probably damaging	1.00
R1993:Trank1	UTSW	9	111378832	missense	probably benign	0.20
R2012:Trank1	UTSW	9	111365028	missense	probably benign
R2025:Trank1	UTSW	9	111392039	missense	probably benign	0.01
R2050:Trank1	UTSW	9	111364788	missense	probably damaging	1.00
R2857:Trank1	UTSW	9	111366933	missense	probably benign	0.00
R2912:Trank1	UTSW	9	111392483	missense	probably damaging	0.98
R2962:Trank1	UTSW	9	111352080	missense	probably damaging	1.00
R3030:Trank1	UTSW	9	111391530	missense	possibly damaging	0.63
R3821:Trank1	UTSW	9	111378819	missense	probably damaging	1.00
R3822:Trank1	UTSW	9	111378819	missense	probably damaging	1.00
R3892:Trank1	UTSW	9	111364759	missense	probably benign	0.03
R4105:Trank1	UTSW	9	111352197	missense	probably damaging	1.00
R4166:Trank1	UTSW	9	111373524	nonsense	probably null
R4237:Trank1	UTSW	9	111367035	missense	probably benign	0.04
R4239:Trank1	UTSW	9	111367035	missense	probably benign	0.04
R4394:Trank1	UTSW	9	111365197	missense	possibly damaging	0.86
R4417:Trank1	UTSW	9	111365968	missense	probably benign	0.17
R4611:Trank1	UTSW	9	111362261	missense	probably damaging	1.00
R4694:Trank1	UTSW	9	111392061	missense	probably benign	0.40
R4731:Trank1	UTSW	9	111390410	missense	probably damaging	1.00
R4843:Trank1	UTSW	9	111366078	missense	probably benign	0.00
R4852:Trank1	UTSW	9	111391895	missense	possibly damaging	0.68
R4859:Trank1	UTSW	9	111365010	missense	probably benign	0.17
R4868:Trank1	UTSW	9	111365641	missense	probably damaging	1.00
R5080:Trank1	UTSW	9	111389221	missense	probably damaging	0.99
R5156:Trank1	UTSW	9	111390694	missense	probably damaging	1.00
R5174:Trank1	UTSW	9	111365559	missense	probably benign	0.00
R5234:Trank1	UTSW	9	111386467	missense	probably damaging	1.00
R5386:Trank1	UTSW	9	111362402	missense	probably benign	0.12
R5419:Trank1	UTSW	9	111391301	missense	probably damaging	1.00
R5435:Trank1	UTSW	9	111391890	missense	probably benign	0.00
R5444:Trank1	UTSW	9	111392958	missense	probably benign	0.04
R5543:Trank1	UTSW	9	111366112	missense	probably damaging	0.97
R5560:Trank1	UTSW	9	111390567	missense	probably damaging	1.00
R5772:Trank1	UTSW	9	111366676	missense	possibly damaging	0.86
R5774:Trank1	UTSW	9	111391226	missense	probably damaging	1.00
R5843:Trank1	UTSW	9	111365860	missense	possibly damaging	0.59
R5858:Trank1	UTSW	9	111392536	missense	probably benign
R5878:Trank1	UTSW	9	111366685	missense	possibly damaging	0.93
R5900:Trank1	UTSW	9	111391716	missense	probably damaging	1.00
R5917:Trank1	UTSW	9	111362417	missense	probably benign	0.38
R5954:Trank1	UTSW	9	111365133	missense	probably benign	0.13
R6041:Trank1	UTSW	9	111377796	missense	possibly damaging	0.94
R6112:Trank1	UTSW	9	111391737	missense	probably damaging	1.00
R6165:Trank1	UTSW	9	111391872	missense	probably benign	0.00
R6255:Trank1	UTSW	9	111352246	critical splice donor site	probably null
R6395:Trank1	UTSW	9	111367200	missense	probably damaging	1.00
R6567:Trank1	UTSW	9	111347521	missense	probably benign	0.02
R6644:Trank1	UTSW	9	111364834	missense	possibly damaging	0.85
R6724:Trank1	UTSW	9	111365916	missense	probably damaging	1.00
R6788:Trank1	UTSW	9	111390679	missense	probably damaging	1.00
R6831:Trank1	UTSW	9	111377899	missense	probably benign	0.00
R6934:Trank1	UTSW	9	111373090	missense	probably damaging	0.99
R7127:Trank1	UTSW	9	111365796	missense	possibly damaging	0.85
R7206:Trank1	UTSW	9	111345515	critical splice donor site	probably null
R7236:Trank1	UTSW	9	111373074	missense	possibly damaging	0.93
R7247:Trank1	UTSW	9	111367512	missense	probably damaging	1.00
R7292:Trank1	UTSW	9	111377870	missense	probably benign	0.02
R7310:Trank1	UTSW	9	111367126	missense	probably damaging	1.00
R7431:Trank1	UTSW	9	111362402	missense	probably benign	0.12
R7448:Trank1	UTSW	9	111366349	missense	probably benign	0.01
R7477:Trank1	UTSW	9	111364957	missense	probably benign	0.00
R7514:Trank1	UTSW	9	111364756	missense	probably damaging	1.00
R7595:Trank1	UTSW	9	111365991	missense	probably damaging	1.00
R7637:Trank1	UTSW	9	111365296	missense	possibly damaging	0.71
R7648:Trank1	UTSW	9	111391685	missense	probably benign
R7737:Trank1	UTSW	9	111366012	nonsense	probably null
R7784:Trank1	UTSW	9	111364103	missense	probably damaging	1.00
R7884:Trank1	UTSW	9	111392516	missense	probably benign
R7912:Trank1	UTSW	9	111391528	missense	probably benign	0.04
R7938:Trank1	UTSW	9	111365028	missense	probably benign
R7979:Trank1	UTSW	9	111377899	missense	probably benign	0.00
R8064:Trank1	UTSW	9	111352076	nonsense	probably null
R8100:Trank1	UTSW	9	111392793	missense	probably damaging	1.00
R8124:Trank1	UTSW	9	111378927	missense	probably benign	0.31
R8198:Trank1	UTSW	9	111390812	missense	probably benign	0.09
R8219:Trank1	UTSW	9	111364909	missense	probably damaging	1.00
R8223:Trank1	UTSW	9	111365889	missense	probably damaging	1.00
R8316:Trank1	UTSW	9	111349302	missense	probably benign	0.38
R8347:Trank1	UTSW	9	111367249	missense	probably damaging	1.00
R8436:Trank1	UTSW	9	111391382	missense	possibly damaging	0.86
R8489:Trank1	UTSW	9	111390275	missense	probably benign	0.01
R8682:Trank1	UTSW	9	111365344	missense	probably benign	0.01
R8768:Trank1	UTSW	9	111389276	missense	probably benign	0.00
R8770:Trank1	UTSW	9	111390824	missense	probably benign	0.00
R8829:Trank1	UTSW	9	111347523	missense	probably benign
R8838:Trank1	UTSW	9	111364905	missense	probably benign	0.03
R8855:Trank1	UTSW	9	111312221	missense	unknown
R8929:Trank1	UTSW	9	111378935	missense	possibly damaging	0.93
R9047:Trank1	UTSW	9	111362432	missense	probably damaging	0.99
R9090:Trank1	UTSW	9	111345479	missense	probably damaging	1.00
R9114:Trank1	UTSW	9	111333775	missense	probably damaging	1.00
R9133:Trank1	UTSW	9	111391702	missense	possibly damaging	0.93
R9177:Trank1	UTSW	9	111392511	missense	probably benign	0.00
R9178:Trank1	UTSW	9	111367200	missense	probably damaging	1.00
R9271:Trank1	UTSW	9	111345479	missense	probably damaging	1.00
R9314:Trank1	UTSW	9	111365981	missense	probably damaging	1.00
R9373:Trank1	UTSW	9	111365191	missense	probably benign	0.25
R9380:Trank1	UTSW	9	111392670	missense	probably benign	0.07
R9435:Trank1	UTSW	9	111364822	missense	probably benign	0.04
R9501:Trank1	UTSW	9	111347875	missense	probably benign	0.00
R9593:Trank1	UTSW	9	111362297	missense	probably benign	0.30
R9601:Trank1	UTSW	9	111373125	missense	probably benign	0.18
R9729:Trank1	UTSW	9	111391469	missense	probably damaging	1.00
X0064:Trank1	UTSW	9	111343236	missense	possibly damaging	0.57
Z1088:Trank1	UTSW	9	111364710	missense	probably damaging	0.99
Z1177:Trank1	UTSW	9	111311902	missense	unknown
Z1177:Trank1	UTSW	9	111367377	missense	possibly damaging	0.83
Z1177:Trank1	UTSW	9	111392870	missense	possibly damaging	0.47

Predicted Primers

PCR Primer
(F):5'- GTCCTGTGTCCTTCGAAAGAAGCTG -3'
(R):5'- ACCGTTTCCACTTTGATGGAACCC -3'

Sequencing Primer
(F):5'- GAGTACAGCATCATGAAGTTCC -3'
(R):5'- CACTTTGATGGAACCCTCCTC -3'

Posted On

2013-05-09