Mutagenetix > Incidental Mutations

Incidental Mutation 'R4518:Ubqlnl'

334071

Institutional Source

Beutler Lab

Gene Symbol

Ubqlnl

Ensembl Gene

ENSMUSG00000051437

Gene Name

ubiquilin-like

Synonyms

LOC244179, 4922504M18Rik

MMRRC Submission

041762-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.101) question?

Stock #

R4518 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

104148259-104150556 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 104149718 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 191 (V191M)

Ref Sequence

ENSEMBL: ENSMUSP00000056365 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051137] [ENSMUST00000059121] [ENSMUST00000154555]

PDB Structure

Solution Structure of RSGI RUH-056, a UBA domain from mouse cDNA [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000051137

SMART Domains

Protein: ENSMUSP00000052174
Gene: ENSMUSG00000044265

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
coiled coil region	47	85	N/A	INTRINSIC
coiled coil region	157	198	N/A	INTRINSIC
OLF	211	468	3.13e-70	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000059121
AA Change: V191M

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000056365
Gene: ENSMUSG00000051437
AA Change: V191M

Domain	Start	End	E-Value	Type
UBQ	31	101	5.13e-16	SMART
Blast:STI1	199	237	8e-11	BLAST
low complexity region	339	350	N/A	INTRINSIC
low complexity region	402	419	N/A	INTRINSIC
PDB:2DNA\|A	561	610	3e-26	PDB
Blast:UBA	568	604	1e-10	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000154555

SMART Domains

Protein: ENSMUSP00000117893
Gene: ENSMUSG00000044265

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
coiled coil region	47	123	N/A	INTRINSIC
OLF	136	304	3.65e-10	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

98% (60/61)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal in terms of growth and behavior. Adult males are fertile and show no apparent defects in spermatogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110082J24Rik	T	A	5: 30,106,008		probably null	Het
Abr	A	G	11: 76,472,518	S167P	possibly damaging	Het
Adamtsl2	T	C	2: 27,095,547	L481P	probably benign	Het
Atp8b3	C	T	10: 80,523,847	M984I	probably benign	Het
Brip1	G	A	11: 86,077,878	A827V	possibly damaging	Het
Carns1	T	G	19: 4,170,070	T389P	probably benign	Het
Ccdc88a	T	C	11: 29,482,651	I1219T	probably benign	Het
Cckar	T	C	5: 53,699,922	N311S	probably damaging	Het
Cenpc1	A	G	5: 86,047,587	S108P	possibly damaging	Het
Chpf	G	T	1: 75,475,045	S588R	probably damaging	Het
Clca3a2	T	A	3: 144,808,705	T414S	probably damaging	Het
Cntrl	A	G	2: 35,148,974	E1092G	probably damaging	Het
Crb2	C	A	2: 37,790,389	T443K	probably damaging	Het
Cwf19l1	A	G	19: 44,133,034	V25A	probably damaging	Het
Cyb561d1	T	C	3: 108,199,571	I111V	possibly damaging	Het
Dbn1	A	T	13: 55,476,229	I350N	possibly damaging	Het
Dnajb4	T	C	3: 152,185,176	I329V	probably benign	Het
Dnmt1	G	T	9: 20,911,978	D1055E	probably benign	Het
Fam122c	G	A	X: 53,293,499	R94H	possibly damaging	Het
Fam168a	C	T	7: 100,834,040	A176V	probably damaging	Het
Farp2	A	G	1: 93,620,641	E1016G	probably benign	Het
Fibcd1	A	T	2: 31,817,195	V350E	probably damaging	Het
Galnt3	C	A	2: 66,093,610	R438L	probably damaging	Het
Golga4	T	A	9: 118,559,008	S1733T	probably benign	Het
Golgb1	G	A	16: 36,929,263	E3076K	probably damaging	Het
Grm7	A	G	6: 110,914,546		probably null	Het
Hcn2	T	C	10: 79,724,702	V289A	probably benign	Het
Hipk1	G	T	3: 103,750,372	H799N	probably damaging	Het
Ispd	G	A	12: 36,473,180	V203I	possibly damaging	Het
Klf14	A	G	6: 30,957,932	S256P	possibly damaging	Het
Muc6	T	A	7: 141,644,222	T1214S	probably benign	Het
Nlrp2	T	A	7: 5,325,056	D666V	possibly damaging	Het
Ntng1	A	G	3: 109,935,013	I148T	probably damaging	Het
Olfr1277	T	C	2: 111,269,918	M150V	probably benign	Het
Olfr39	A	G	9: 20,286,250	I184V	probably benign	Het
Olfr845	T	A	9: 19,339,260	S267T	possibly damaging	Het
Orc4	G	A	2: 48,937,489	P31S	probably benign	Het
Pacs2	A	G	12: 113,060,669	D360G	probably benign	Het
Parp8	C	A	13: 116,895,673	L321F	possibly damaging	Het
Pdss2	T	A	10: 43,372,150	S217T	probably damaging	Het
Plekhn1	T	C	4: 156,225,531	S109G	probably damaging	Het
Ppil2	A	T	16: 17,096,041	F173I	possibly damaging	Het
Prlr	C	A	15: 10,328,999	T520K	possibly damaging	Het
Prokr2	T	A	2: 132,374,092		probably null	Het
Rab3gap2	G	A	1: 185,267,068	V991I	probably benign	Het
Reln	T	C	5: 21,901,743	I3210V	probably benign	Het
Rims2	T	C	15: 39,437,526	Y218H	probably damaging	Het
Slc41a1	T	C	1: 131,839,125	V127A	probably damaging	Het
St8sia6	T	A	2: 13,792,751		probably null	Het
Tlr6	A	G	5: 64,954,904	F220S	possibly damaging	Het
Trmt1l	C	T	1: 151,448,343	Q314*	probably null	Het
Vnn3	G	A	10: 23,867,226	V445M	possibly damaging	Het
Zfhx4	T	C	3: 5,412,518	C3398R	probably damaging	Het
Zfyve16	T	C	13: 92,521,312	E697G	possibly damaging	Het

Other mutations in Ubqlnl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00158:Ubqlnl	APN	7	104149165	missense	probably benign
IGL01592:Ubqlnl	APN	7	104150289	unclassified	probably benign
IGL01972:Ubqlnl	APN	7	104149697	missense	probably benign	0.00
IGL02266:Ubqlnl	APN	7	104149547	nonsense	probably null
IGL02447:Ubqlnl	APN	7	104148649	missense	probably damaging	1.00
IGL03232:Ubqlnl	APN	7	104148629	missense	possibly damaging	0.71
FR4737:Ubqlnl	UTSW	7	104149835	unclassified	probably benign
R0066:Ubqlnl	UTSW	7	104148938	missense	probably damaging	0.98
R0066:Ubqlnl	UTSW	7	104148938	missense	probably damaging	0.98
R0077:Ubqlnl	UTSW	7	104150047	missense	probably damaging	1.00
R0109:Ubqlnl	UTSW	7	104150192	missense	probably damaging	1.00
R0109:Ubqlnl	UTSW	7	104150192	missense	probably damaging	1.00
R0517:Ubqlnl	UTSW	7	104148638	missense	probably damaging	1.00
R1129:Ubqlnl	UTSW	7	104149650	missense	probably damaging	0.98
R1885:Ubqlnl	UTSW	7	104150065	missense	possibly damaging	0.88
R1987:Ubqlnl	UTSW	7	104148485	missense	probably benign
R2151:Ubqlnl	UTSW	7	104148683	missense	probably benign	0.00
R2152:Ubqlnl	UTSW	7	104148683	missense	probably benign	0.00
R2153:Ubqlnl	UTSW	7	104148683	missense	probably benign	0.00
R3712:Ubqlnl	UTSW	7	104149138	missense	probably benign	0.03
R3914:Ubqlnl	UTSW	7	104149606	missense	probably benign
R4367:Ubqlnl	UTSW	7	104149718	missense	probably benign	0.00
R4404:Ubqlnl	UTSW	7	104149718	missense	probably benign	0.00
R4405:Ubqlnl	UTSW	7	104149718	missense	probably benign	0.00
R4406:Ubqlnl	UTSW	7	104149718	missense	probably benign	0.00
R4407:Ubqlnl	UTSW	7	104149718	missense	probably benign	0.00
R4449:Ubqlnl	UTSW	7	104149718	missense	probably benign	0.00
R4458:Ubqlnl	UTSW	7	104149189	missense	probably benign	0.01
R4508:Ubqlnl	UTSW	7	104149718	missense	probably benign	0.00
R4516:Ubqlnl	UTSW	7	104149718	missense	probably benign	0.00
R4517:Ubqlnl	UTSW	7	104149718	missense	probably benign	0.00
R4522:Ubqlnl	UTSW	7	104149718	missense	probably benign	0.00
R4523:Ubqlnl	UTSW	7	104149718	missense	probably benign	0.00
R4524:Ubqlnl	UTSW	7	104149718	missense	probably benign	0.00
R4529:Ubqlnl	UTSW	7	104149718	missense	probably benign	0.00
R4531:Ubqlnl	UTSW	7	104149718	missense	probably benign	0.00
R4738:Ubqlnl	UTSW	7	104149718	missense	probably benign	0.00
R4739:Ubqlnl	UTSW	7	104149718	missense	probably benign	0.00
R4740:Ubqlnl	UTSW	7	104149718	missense	probably benign	0.00
R5339:Ubqlnl	UTSW	7	104149765	missense	probably benign	0.00
R5357:Ubqlnl	UTSW	7	104148931	missense	probably damaging	1.00
R5386:Ubqlnl	UTSW	7	104149217	missense	probably benign	0.01
R5542:Ubqlnl	UTSW	7	104149697	nonsense	probably null
R5588:Ubqlnl	UTSW	7	104149132	missense	probably damaging	1.00
R6058:Ubqlnl	UTSW	7	104148752	missense	probably benign
R6084:Ubqlnl	UTSW	7	104148698	missense	probably benign	0.01
R6207:Ubqlnl	UTSW	7	104148708	missense	possibly damaging	0.73
R6794:Ubqlnl	UTSW	7	104148785	missense	probably benign	0.34
R7500:Ubqlnl	UTSW	7	104148841	missense	probably damaging	1.00
R7575:Ubqlnl	UTSW	7	104148490	missense	probably damaging	1.00
R8491:Ubqlnl	UTSW	7	104149375	missense	probably benign	0.22
Z1088:Ubqlnl	UTSW	7	104149993	missense	probably damaging	1.00
Z1177:Ubqlnl	UTSW	7	104148628	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- CCAAGAATGGCTGTGAGTTTGG -3'
(R):5'- ATCCCTGCCATCAAGACAGG -3'

Sequencing Primer
(F):5'- GTGGATACTCAGGGTTCTGTGC -3'
(R):5'- CCCTAAAGGAAATAGCAGCATG -3'

Posted On

2015-08-18